Transcript asmbl_25956

Sequence
Transcript Sequence for observation asmbl_25956 of TGE0000920:
GTGGCGGCCGCAGTGTCGCAGGCCGGAGGGAAGATGGCGGCGCCCTGGTGGCGAGCCGCGCTGTGCGAGTGTCGGAGATGGCGGGGCTTCAGCACCTCGGCCGTCCTGGGCCGCCGGACACCCCCGCTGGGGCCGATGCCCAACAGTGACATCGACTTGAGCAACCTGGAGCGGCTGGAGAAGTACCGGAGCTTCGACCGCTACCGGCGCCGAGCAGAGCAGGAGGCGCAGGCCCCGCACTGGTGGCGGACCTACCGAGAGTATTTCGGGGAGAAGACAGATCCCAAAGAGAAGATTGATATTGGGCTGCCTCCACCCAAAGTCTCCCGGACCCAACAGCTACTGGAACGGAAACAGGCCATCCAGGAGCTTCGGGCCAATGTGGAAGAGGAGCGGGCTGCCCGCCTCCGCACAGCCAGTGTCCCGCTGGATGCCGTGCGGGCCGAGTGGGAGAGGACCTGTGGCCCCTACCACAAGCAGCGTCTGGCTGAGTATTACGGCCTCTACCGAGACCTGTTCCACGGTGCCACCTTTGTGCCCCGAGTCCCCCTGCACGTGGCCTACGCTGTGGGTGAGGATGACCTGATGCCTGTGTACTGTGGCAATGAGGTGACTCCAACCGAGGCTGCCCAAGCGCCAGAGGTGACCTATGAGGCAGAAGAGGGCTCCTTGTGGACGTTGCTACTCACTAGCTTGGATGGGCACCTGCTGGAGCCAGATGCTGAGTACCTCCACTGGCTGCTAACCAACATCCCGGGTAACCGGGTGGCTGAAGGACAGGTGACGTGTCCCTACCTCCCCCCCTTCCCTGCCCGAGGCTCCGGCATCCACCGTCTTGCCTTCCTGCTCTTCAAGCAGGACCAGCCGATTGACTTCTCTGAGGACGCACGCCCCTCACCCTGCTATCAGCTGGCCCAGCGGACCTTCCGCACTTTTGATTTCTACAAGAAACACCAAGAAACCATGACTCCAGCCGGCTTGTCCTTCTTCCAGTGCCGCTGGGATGACTCCGTCACCTACATCTTCCACCAGCTTCTGGACATGCGGGAGCCGGTGTTTGAGTTCGTGCGGCCGCCCCCTTACCACCCCAAGCAGAAGCGCTTCCCCCACCGGCAGCCCCTGCGCTACCTGGACCGGTACAGGGACAGTCATGAGCCCACCTATGGCATCTACTAAGGAGCCAGAGTGTGCGCATTTCAGAGCATGGGATTGATCGGCAGCAAGAGTAAAGACACAGCTCCAGAGGCCCACACTGTGGGGTCTGGGCCCTGCCTTAGGCAGCCCCCCTCTTTGGCCCCCTCCCGTCAGGCCCAGGGCTTGGAGTGAAAGTGACTCTCAGGTGGTGGGGTGGGGAATGTGAATAAACATGATTTCTTGCCGGG