Transcript asmbl_66436

Sequence
Transcript Sequence for observation asmbl_66436 of TGE0057062:
CCTCGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCTGTACCTTCTTTCTGGCAGTGAATGGTCTGTATTCCTCTAGTGATGATGTGATCGAATTAACTCCATCGAATTTCAACCGAGAAGTTATTCAGAGTGATAGTTTGTGGCTTGTAGAATTCTATGCTCCATGGTGTGGTCACTGTCAAAGATTAACACCAGAATGGAAGAAAGCAGCAACTGCATTAAAAGATGTTGTCAAAGTTGGTGCAGTTGATGCAGATAAGCATCATTCCCTAGGAGGTCAGTATGGTGTTCAGGGATTTCCTACCATTAAGATTTTTGGATCCAACAAAAACAGACCAGAAGATTACCAAGGTGGCAGAACTGGTGAAGCCATTGTAGATGCTGCGCTGAGTGCTCTGCGCCAGCTCGTGAAGGATCGCCTCGGGGGACGGAGCGGAGGATACAGTTCTGGAAAACAAGGCAGAAGTGATAGTTCAAGTAAGAAGGATGTGATTGAGCTGACAGACGACAGCTTTGATAAGAATGTTCTGGACAGTGAAGATGTTTGGATGGTTGAGTTCTATGCTCCTTGGTGTGGACACTGCAAAAACCTAGAGCCAGAGTGGGCTGCCGCAGCTTCAGAAGTAAAAGAGCAGACGAAAGGAAAAGTGAAACTGGCAGCTGTGGATGCTACAGTCAATCAGGTTCTGGCCTCCCGATACGGGATTAGAGGATTTCCTACAATCAAGATATTTCAGAAAGGCGAGTCTCCTGTGGATTATGACGGTGGGCGGACAAGATCCGACATCGTGTCCCGGGCCCTTGATTTGTTTTCTGATAACGCCCCACCTCCTGAGCTGCTTGAGATTATCAACGAGGACATTGCCAAGAGGACGTGTGAGGAGCACCAGCTCTGTGTTGTGGCTGTGCTGCCCCATATCCTTGATACTGGAGCTGCAGGCAGAAATTCTTATCTGGAAGTTCTTCTGAAGTTGGCAGACAAATACAAAAAGAAAATGTGGGGGTGGCTGTGGACAGAAGCTGGAGCCCAGTCTGAACTTGAGACCGCGTTGGGGATTGGAGGGTTTGGGTACCCCGCCATGGCCGCCATCAATGCACGCAAGATGAAATTTGCTCTGCTAAAAGGCTCCTTCAGTGAGCAAGGCATCAACGAGTTTCTCAGGGAGCTCTCTTTTGGGCGTGGCTCCACGGCACCTGTAGGAGGCGGGGCTTTCCCTACCATCGTTGAGAGAGAGCCTTGGGACGGCAGGGATGGCGAGCTTCCCGTGGAGGATGACATTGACCTCAGTGATGTGGAGCTTGATGACTTAGGGAAAGATGAGTTGTGAGAGCCACAACAGAGGCTTCAGACCATTTTCTTTTCTTGGGAGCCAGTGGATTTTTCCAGCAGTGAAGGGACATTCTCTACACTCAGATGACTCTACCAGTGGCCTTTTAACCAAGAAGTAGTACTTGATTGGTCATTTGAAAACACTGCAACAGTGAACTTTTGCATCTCAAGAAAACATTGAAAAATTCTATGAATTGTTGTAGCCGGTGAATTGAGTCGTATTCTGTCACATAATATTTTGAAGAAAACTTGGCTGTCGAAACATTTTTCTCTCTGACTGCTGCTTGAATGTTCTTGGAGGCTGTTTCTTATGTATGGGTTTTTTTTAATGTGATCCCTTCATTTGAATATTAATGGCTTTTTCCATTAAAGAATAAAATATTTTGGACAATGCCGATAAATGTATGAAGTTAGTATCCACATCATAAATTCAGAGTGATGTTTAGCAGTAAATCAATATTTTGAAGTGATACACAGATGTCTTTCCTCCCCACAAACTTTTTTAAACAAAAAACAAGACCTCTTTTCTTTAGATGGTGCCACCTATGCCCACCACAACAGAGATTTTACATGGAAACCGGGCTCAGTGAGAACTGATTTCCTGCCCAATATTTGTCTTTGGGCTGTCTCTAGTGACTAATTATTAAGGAATCTAGCTGGTTATACAGTTCAAGGCTTTCTATGTTGTTAATGAACCTCAAAATAGCCGTTAAGACATGAAATACAGCAGCAGGTTACCAATGCGAACAGGTAGTTCGCATTTATGTAAAACATTCAGAAAATGAAGTTTTGAATTTGTTGGAACATTCAAAGGACTTGAGAGCATTTTATTGTAACTTAAAAAAATAAATACAACTGTCACTAA