Transcript asmbl_66109

Sequence
Transcript Sequence for observation asmbl_66109 of TGE0056297:
GGTGCGCTTCCTGGAGCAGCAGAACGCGGCGCTCGCCGCCGAAGTGAACCGGCTCAAGGGCCGCGAGCCGACGCGAGTGGCCGAGCTCTACGAGGAGGAGCTGCGGGAGCTGCGGCGCCAGGTGGAGGTGCTCACTAACCAGCGCGCGCGCGTCGACGTCGAGCGCGACAACCTGCTCGACGACCTGCAGCGGCTCAAGGCCAAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGCAGATGCGGGAATTGGAGGACCGATTTGCCAGTGAGGCCAGTGGCTACCAGGACAACATTGCGCGCCTGGAGGAGGAAATCCGGCACCTCAAGGATGAGATGGCCCGCCATCTGCGCGAGTACCAGGACCTGCTCAACGTGAAGATGGCCCTGGATGTGGAGATTGCCACCTACCGGAAGCTGCTGGAGGGAGAGGAGAGCCGGATCAATCTCCCCATCCAGACCTACTCTGCCCTCAACTTCCGAGAAACCAGCCCTGAGCAAAGGGGTTCTGAGGTCCATACCAAGAAGACGGTGATGATCAAGACCATCGAGACACGGGATGGGGAGGTCGTCAGTGAGGCCACACAGCAGCAGCATGAAGTGCTCTAAAGACAGAGACCCTCTGCCACCAGAGACCGTCCTCACCCCTGTCCTCACTGCTCCCTGAAGCCAGCCTTCTTCCATCCCAGGACACCACACCCAGCCTCAGTCCTCCCCTCACAGCCTCTGACCCCTCCTCACTGGCCATCCCTCGTGGTCCCCAACAGCGACATAGCCCATCCCTGCCTGGTCACAGGGCATGCCCCGGCCACCTCTGCGGACCCCAGCTGTGAGCCTTGGCTGTTGGCAGTGAGTGAGCCTGGCTCTTGTGCTGGATGGAGCCCAGGCGGGAGCGGTGGCCCTGTCCCTCCCACCTCTGTGACCTCAGGCACTAGCCTTTGGCTCTGGAGACAGCCCCAGAGCAGGGTGTTGGGATACTGCAGGGCCAGGACTGAGCCCCGCAGACCTCCCCAGCCCCTAGCCCAGGAGAGAGAAAGCCAGGCAGGTAGCCAGGGGGACTAGCCCCTGTGGAGACTGGGGGGCTTGAAATTGTCCCCGTGGTCTCTTACTTTCCTTTCCCCAGCCCAGGGTGGACTTAGAAAGCAGGGGCTACAAGAGGGAATCCCCGAAGGTGCTGGAGGTGGGAGCAGGAGATTGAGAAGGAGAGAAAGTGGGTGAGATGCTGGAGAAGAGAGGAGAGGAGAGAGGCAGAGAGCGGTCTCAGGCTGGTGGGAGGGGCGCCCACCTCCCCACGCCCTCCCCTCCCCTGCTGCAGGGGCTCTGGAGAGAAACAATAAAGAGATTCACACACAAGC