Transcript asmbl_59206

Sequence
Transcript Sequence for observation asmbl_59206 of TGE0001130:
CGGCTGGCCCGGCCGGCCTGGGCTTGGGCCTCCTCCAAGACTCGCCTGGCAGGAGGGCGGAGGCACCCCGGGAGGCTATAAGGCCCTCTCCTCCACCCTGCCAGGCTCACTCTGCCCCACAGCCACAGCCCCTGACTGCCGCAGCCCCCACAGAGCCCGCCGCGCACCCCACGTCCCCCACGCCAGCGCCCAGCCATGGAGGCCATCAAGAAGAAAATGCAGATGCTGAAGTTGGACAAGGAGAATGCCATCGACCGCGCGGAGCAGGCGGAGGCGGATAAGAAAGCCGCTGAGGACAAGTGCAAGCAGGTGGAGGAGGAGCTGACGCACCTCCAGAAGAAACTAAAAGGGACAGAGGACGAGCTGGATAAATATTCCGAGGACCTGAAGGACGCGCAGGAGAAGCTGGAGCTCACGGAGAAGAAGGCCTCCGACGCTGAAGGTGATGTGGCCGCCCTCAACCGACGCATCCAGCTCGTTGAGGAGGAGTTGGACAGGGCTCAGGAACGACTGGCCACGGCCCTGCAGAAGCTGGAGGAGGCAGAAAAAGCTGCAGATGAGAGTGAGAGAGGAATGAAGGTGATAGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAGATTCAGGAGATGCAGCTCAAAGAGGCCAAGCACATTGCGGAAGAGGCTGACCGCAAATACGAGGAGGTAGCTCGTAAGCTGGTCATCCTGGAGGGTGAGCTGGAGAGGGCAGAGGAGCGTGCGGAGGTGTCTGAACTAAAATGTGGTGACCTGGAAGAAGAACTCAAGAATGTTACTAACAATCTGAAATCTCTGGAGGCTGCATCTGAAAAGTATTCTGAAAAGGAGGACAAATATGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGAGAAACTTGCCCAGGCCAAAGAAGAGAACGTGGGCTTACATCAGACACTGGATCAGACACTAAACGAACTTAACTGTATATAAGCAAAACAGAAGAGTCTTGTTCCAACAGAAACTCTGGAGCTCCGTGGGTCTTTCTCTTCTCTTGTAAGAAGTTCCTTTTGTTATTGCCATCTTCGCTTTGCTGGAAATGTCAAGCAAATTATGAATACATGACCAAATATTTTGTATCGGAGAAGCTTTGAGCACCAGTTAAATCTCATTCCTTCCCTTTTTTTTTCAAATGGCACCAGCTTTTTCAGCTCTCTTATTTTTTCCTTAAGTAGCATTTATTCCTAAGGTAGGCAGGGTATTTCCTAGTAAGCATACTTTCTTAAGACGGAGGCCATTTGGTTCCTGGGAGAATAGGCAGCCCCACACTTTGAAGAATACAGACCCCAGTATCTAGTCGTGGATATAATTAAAACGCTGAAGACCATAACCTTTTGGGTCAACTGTTGGTCAAACTATAGGAGAGACCAGGGACCATCACATGGGTAGGGATTTTCCATCCAGAGCCAATAAAAGGACTGGTGGGGGCCGGGGGTGGCTATTGTGGGAAGTCATAACCCACAGATAGATCAACCTAAGAATCCTGGCCCTTCTCCACTCTCCACCATGCAGGACAAACATCTTCTCAAGCAGTCAACGTAGAATGCTTGGGAAATAGTCATAATTACCCACATATAGTAATTAATAGATGGTAATTAATTGATCCTTGATGTGATGTTCTTTTGCATATTTCCTTCATTCTAAAGTTGTTCCCTGGCCGGGAGCGTTGGCTTTCGCCTGTAATCCCAACACTTTGGGAGGCTGAGGCGGGTGGATCACCTGAGGTCAGGAGT