Transcript asmbl_56774

Sequence
Transcript Sequence for observation asmbl_56774 of TGE0000954:
TGCGGGCCAAGAAAGGTGACCGGGCTTCCTTCCGGCTTGCTAAGCAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCAACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAATAACTTCAAATTCCAGCCAAACGTTCCTTGTTGCCACTTTGGGTATTCTGAGATTTTCTCTTGCATGCCCTTAGCTTTACAGCTTTTGCATTTCCTGTTGTATTTATTCTCAGCCATTTTGGGCATATGTATCTTTATAATCAGACTGGAAACGGGACTTTCTATTAATATCATTTTCAGAATAAAAAATAGGATAATTTAACCTACCAGCCCTTCTCCCCCAATAACTGTGGTCTATACAGAGTCAATATATTTTTTCAGAGAAAGTTATTCGCTCGATTTTTTCTGAATCATAATTAAACTTTATGATAAAATA