Transcript asmbl_24945

Sequence
Transcript Sequence for observation asmbl_24945 of TGE0004430:
GGATCTGGGGTGGAGTAGGGGAAGCGGTGGAGAAGGGTAGGGTAGGGTAGCTGAGCAAGTTCGTTCACCTTAGTCCGACTCTTCGTCGTGAGAGAAGCTGGCCAAGGGGGCCGGGGCTTGCACTACACTTCCCGGGAGGCTGTGCGCAGCGGCGCGTCCCGTAACGGGAGCGCGGGCTTTGGAAGGCAGCGGAGCGAGAGGTGATCTGCGGCTGAGCTGAAGCGGTAGCGGGGCTGAGGACTGTCCTGGGCGACACCGGACCAAGCGCTAGCTGCCGAGGCCTCGTGCCCCTAGGCCAGCCGTTCCTCCTCCGTGTCGCTATGGGTATTCAAGGCCTGGCCAAACTGATTGCTGATGTGGCCCCCAGTGCCATCCGGGAGAATGACATCAAGAGCTACTTCGGCCGCAAGGTGGCCATCGATGCCTCCATGAGCATTTATCAGTTCCTGATTGCCGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATCCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTCGATGGCAAGCCGCCACAGCTCAAATCGGGTGAGCTGGCCAAACGCAGCGAGCGGCGGGCTGAGGCCGAGAAGCGGCTACAGCAGGCTCAGGATGTTGGGACTGAGGAGGACGTGGAGAAGTTTACTAAGCGACTAGTGAAGGTCACCAAGCAACACAATGATGAGTGCAAGCATCTACTGAGCCTCATGGGCATCCCGTACCTCGATGCGCCCAGCGAGGCAGAGGCCAGCTGTGCAGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCCACGGAGGACATGGATTGCCTGACCTTTGGCAGCCCTGTGCTAATGCGGCACCTGACTGCCAGCGAGGCCAAGAAGCTACCCATCCAGGAATTCCACCTGAGCCGGATTCTTCAGGAGCTGGGCCTGAACCAGGAGCAGTTTGTGGACCTCTGCATCCTGCTGGGCAGCGACTACTGTGAGAGCATTCGAGGCATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTGCGTCGACTTGACCCCAGCAAGTACCCCGTGCCGGAAAACTGGCTCCACAAAGAGGCCCAGCAGCTCTTCCTAGAGCCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGTGAACCAAACGAAGAAGAGCTCGTCAGGTTCATGTGCGGCGAAAAGCAGTTCTCCGAGGAGCGAATCCGCAGTGGGGTCCGGCGGCTGAGCAAGAGCCGCCAGGGCAGCACGCAGGGCCGCCTGGATGATTTCTTCAAGGTGACCGGCTCGCTCTCGTCAGCGAAGCGCAAGGAGCCCGAACCCAAGGGATCCGTGAAGAAGAAGGCGAAGACTGGGGCGGCAGCAGGGAAGTTTAAGAGGGGAAAATAAACAAGTTCCCCTTCAGTACACCTCCGTGCCCAGAGTTATCTGCCCCGTCCCCTTGAGGGCTGGCACTGGAGAAGCCTCCCCTGGGGCAGGGAGGGGACTGCGTTGCTTCTGTGGCATGCGCCTTCTCAGTACTGCAGTTCCCTTTTTTACTTGATCTTATGGCAGGAAAGCCGCAGAGGTACTTTGTTTTCTTCTTTTTTTAGCTCAGGAAAGTATGTCAGCCTCAAACTACCTTTCACTTTAATGGACACTGAATTCATTGTTACGTAAAAGTGATAGCAACAGGTTTTGAAGAAGGGAGAGGGAGAGAAATGGTGGAGACAAAAGACTTTACAGAAGTGATTTCCTGGCTGGCCAGCCGGTGGCCGGTGATGGCGGAACCAGACCACGCTTCTCTGGTTCAGCCTTGACCCACCATGAAGGAAGGACAGCCGGCAGGAAGACCCGGTCTTAGCAAATAGGAAGAGCTACTAAGAAATAAGACAGGCAGAGAGCTGGAGTACATGGACTTGGCAACAAGGGTTCGATTACTGGCTGTGTGTCCTGGGGTGGGCAGAAACTTGAACTTGCTGTGTAACTTGAGTCTTTAGTCATTATTTAGAGGCATAAGGTGGTGAAGTTCTTCTCATGGCCTTTCTGAGGCAATCAACTGAGTCGAGACTTTGGGAAAAGATGCTGTTATGTTTTTGTTTTAAGGTTATGAGAAAAGAGTCAATAAAATTATAAAAG