Transcript asmbl_25947

Sequence
Transcript Sequence for observation asmbl_25947 of TGE0000918:
CCCGGGCCCAGGTCAGCTTCTCTCAGGGTTCAGCCCAGCCTGGGCACAGCACATGGATGGGGCAGGATGCTGCCCGCCTGTTCTGGGCCCCCCCGCCCCCTGCTGAGAGCGTTGTCCCCTTCCCAGGGCCTCTGTAGGAGGGTGGGGCGGGGCCAGGCCTGCCCACGGGGTCCACCTTCTGCTCCAGCCAGAGGAGGGTCCTGTAGGGATCCCAGCTGGGGAAGGTGCAGGGGGCCTGGGAGACTGCCTCTCCGAAGCGGTGAAACCCTCACCCTTCCGTCCCTCCCAGCCACCCTCCCTAAAACTTCCCCTGACAGAGGGTGGCAGCCCCAGGCTCTTTGCATAATCCTGTGGCTTCGCTGTCTTCACCCAGCACCAGCGGACAGGGAAGGGCAGAGAAGGCCACCATGGCGACACTCCTCTCCCATCCGCAGCAGCGCCCTCCCTTCTTGCGCCAGGCCATCAAGATAAGGCGCCGCAGAGTCAGAGATCTACAGGATCCCCCGCCCCAAATGGCCCCGGAGATCCAGCCTCCATCCCACCACTTCTCCCCCGAGCAGCGGGCCCTGCTCTACGAGGACGCACTCTACACTGTCTTGCACCGCCTGGGTCATCCTGAGCCCAACCATGTGACGGAGGCCTCTGAGCTGCTGCGATACCTGCAGGAGGCCTTCCACGTGGAGCCCGAGGAGCACCAGCAGACACTGCAGCGGGTCAGGGAGCTTGAGAAGCCAATATTTTGTCTGAAGGCAACAGTGAAACAGGCCAAGGGCATTCTGGGCAAAGATGTCAGTGGGTTCAGCGACCCCTACTGCCTGCTGGGCATTGAGCAGGGGGTAGGTGTGCCAGGGGGCAGCCCCGGGTCCCGGCATCGGCAGAAGGCTGTGGTGAGGCACACCATCCCCGAGGAGGAGACCCACCGCACGCAGGTCATCACCCAGACACTCAACCCCGTCTGGGACGAGACCTTCATCCTGGAGTTTGAGGACATCACCAATGCGAGCTTTCATCTGGACATGTGGGACCTGGACACTGTGGAGTCTGTCCGACAGAAGCTTGGGGAGCTCACGGATCTGCATGGGCTTCGCAGGATCTTTAAAGAGGCCCGGAAGGACAAAGGCCAGGACGACTTTCTGGGGAACGTGGTTCTGAGGCTGCAGGACCTGCGCTGCCGAGAGGACCAGTGGTACCCCCTGGAACCCCGCACTGAGACCTACCCAGACCGAGGCCAGTGCCACCTCCAGTTCCAACTCATCCATAAGCGGAGAGCCACTTCGGCCAGCCGCTCGCAGCCGAGCTACACCGTGCACCTCCACCTCCTGCAGCAGCTTGTGTCCCACGAGGTCACCCAGCACGAGGCGGGAAGCACCTCCTGGGACGGGTCGCTGAGTCCCCAGGCTGCCACCGTCCTCTTTCTGCACGCCACACAGAAGGACCTATCCGACTTCCACCAGTCCATGGCGCAGTGGCTGGCCTACAGCCGCCTCTACCAGAGCCTGGAGTTCCCCAGCAGCTGCCTCCTGCACCCCATCACCAGCATCGAGTACCAGTGGATCCAGGGTCGGCTCAAGGCAGAACAGCAGGAGGAGCTGGCCGCCTCATTCAGCTCCCTGCTGACCTACGGCCTCTCCCTCATCCGGAGGTTCCGCTCTGTCTTCCCCCTCTCTGTCTCGGACTCCCCAGCCCGGCTGCAGTCTCTTCTCAGGGTCCTGGTACAGATGTGCAAGATGAAGGCCTTTGGAGAACTGTGCCCCAACACCGCCCCATTGCCCCAGCTGGTGACTGAGGCCCTGCAGACTGGCACCACTGAATGGTTCCACCTGAAGCAGCAGCACCATCAACCCATGGTGCAGGGCATCCCGGAGGCAGGCAAGGCCTTGCTGGGCCTGGTACAGGATGTCATTGGCGACCTGCACCAGTGCCAGCGCACATGGGACAAGATCTTCCACAATACCCTCAAGATCCACCTCTTCTCCATGGCTTTCCGGGAGCTGCAGTGGCTGGTGGCCAAGCGGGTGCAGGACCACACGACGGTTGTGGGTGATGTAGTGTCCCCAGAGATGGGCGAGAGTCTGTTCCAGCTCTACATCAGCCTCAAGGAGCTCTGCCAGCTGCGCATGAGCTCCTCAGAGAGGGATGGAGTCCTGGCCCTGGATAATTTCCACCGCTGGTTCCAGCCGGCCATCCCCTCCTGGCTGCAGAAGACGTACAACGAGGCCCTGGCGCGGGTGCAGCGCGCTGTGCAGATGGATGAGCTGGTGCCCCTGGGTGAACTGACCAAGCACAGCACATCAGCGGTGGATCTATCCACCTGCTTTGCCCAGATCAGCCACACTGCCCGGCAGCTGGACTGGCCAGACCCAGAGGAGGCCTTCATGATTACCGTCAAGTTTGTGGAGGACACCTGTCGCCTGGCCCTGGTGTACTGCAGCCTTATAAAGGCCCGGGCCCGCGAGCTCTCTTCAGGCCAGAAGGACCAAGGCCAGGCAGCCAACATGCTGTGTGTGGTGGTGAATGACATGGAGCAGCTGCGGCTGGTGATCGGCAAGTTGCCCGCCCAGCTGGCATGGGAGGCCCTGGAGCAGCGGGTAGGGGCCGTGCTGGAGCAGGGGCAGCTGCAGAACACGCTGCATGCCCAGCTGCAGAGCGCGCTGGCCGGGCTGGGCCATGAGATCCGCACTGGCGTCCGCACCCTGGCCGAGCAGTTGGAGGTGGGCATCGCCAAGCACATCCAGAAACTGGTGGGCGTCAGGGAGTCTGTCCTGCCTGAGGATGCCATTCTGCCCCTGATGAAGTTCCTGGAGGTGGAGCTTTGCTACATGAACACCAACTTGGTGCAGGAGAACTTCAGCAGCCTCCTGACCCTGCTCTGGACCCACACACTCACAGTGCTGGTGGAGGCGGCCGCCTCCCAGCGCAGCTCATCCCTGGCTTCCAACAGGCTGAAGATTGCCCTGCAGAACCTGGAGATCTGCTTCCACGCTGAGGGCTGTGGCCTGCCACCCAAGGCCCTGCACACTGCCACCTTCCAGGCTCTGCAGAGGGACCTGGAGCTGCAGGCGGCCTCCAGCCGGGAACTCATCCGGAAGTACTTCTGCAGCCGAATCCAGCAGCAGGCAGAAACCACCTCTGAGGAGCTGGGGGCTGTGACAGTCAAGGCCTCCTACCGCGCCTCTGAGCAGAAGCTGCGTGTGGAGCTGCTCAGCGCCTCCAGCCTGCTGCCCCTGGACTCCAATGGCTCCAGCGACCCCTTTGTCCAGCTGACCTTGGAGCCCAGGCATGAGTTCCCTGAGCTGGCCGCCCGGGAGACCCAGAAGCACAAGAAGGACCTTCACCCATTGTTTGATGAGACCTTTGAATTCCTGGTGCCTGCTGAGCCGTGCCGCAAGGCTGGGGCATGCCTCCTGCTCACCGTGCTGGACTACGACACGCTGGGGGCCGACGACCTGGAAGGCGAGGCCTTCCTGCCGCTGCGTGAGGTGCCCGGGCTGAGTGGCTCTGAGGAGCCTGGTGAGGTGCCTCAGACCCGCCTGCCCCTCACGTACCCCGCACCCAACGGGGACCCAATCCTGCAGCTGCTGGAGGGCCGGAAGGGTGACCGAGAAGCCCAGGTCTTTGTGAGGCTGCGGCGGCACCGGGCCAAGCAGGCCTCCCAGCATGCCTTGCGGCCGGCACCGTAGCCGTAGAGGTTTGCGGTGGGGCTGGGTCCCCGGTGGGGACTTGCAAGGGCTTTCCTGTAGGGTCTGGGGCTTCCCCGCCACATCGCGGCCCTCCAGCCTGGCCTAACACTTGGGGAGCCCCAGCATGCGGAGTGCCCAGAGTGCAGACCTCCCCTGCCTCCCATGGTGATGGGGGCTCAGCAGCGACATCTCTACTCCCGCCTCCCTGCCTCCAGCCCTGGCTGCAATGTCTCTACCACATCCCAGCACCAGGGGGAGCAAACCCTGCCCCTGCCCGCCTCTCAGAAAAGCTGCTGTGGTGGGCAGGGGATTGGGCCATCTGTCTCCTGGCCCTGGCCCATCTGCCTCCTGGCCTTCCTGTTCCAGCCACTGGGGTGGGGGCCAGGTTCACTGGGACCAGGGCTACAGGCACAGAGTCTCCTGGAAAAGGGAGAGGGGACCCTGCCAAAGATGAGGCTCCAGCTGCCCTGGGGGGAGGGTGGTGGCCATTACTAGAGGGGGCCTGGGTCCTCTCCCCAGGGGCTGCCAGCATCCAGGCCAGGAAGCCTGGAGCCAAGAACCTTCTGGCTCTGAGGGAGCAAGAGCTGGCAGGCGGCAGGGCTGGCACAGACAGACGGAAGCAGAAAGGACAGTTTGGCTGCTGTGTCTGCTGCGCACGCCCCCTCCCCGGACAGCACCTGCCACCTAGAAACTTTCTTAGCAAAAAAATTAATAAAAACAAATCCA