Transcript asmbl_31161

Sequence
Transcript Sequence for observation asmbl_31161 of TGE0058164:
GGCTAGAGAGCTGGGGGTCCAGGGGTGGAGCTAAGAAGGATCTGCTCCCCAGGCTGGGTCAGTTAGGGGCTCACAGTGGGATCCTGTTAGGTGTGGGTGGATGAGAGTCAGGGTCCATCAGTGTATTCATTTAACTGTTCATTTGTATAACCCCGTTTAAGAATACTGTCCTCCAAGTGCCAAGAATGGTGCTCAGGGGATTACCACCTAATTGCTGACTCAAGTTGCTGGTTTGCAATGGGCACAGAACTTCTCTTAGTAGGTGGCATGAGTTGAGAAGGTTCTGGATCAGAGATAGGGGCCCCTCTGATCACCTCCACTCCTATAGGTATGAGACAGAGCTGGCCATGCGCCAGTCTGTGGAGAACGACATCCATGGGCTCCGCAAGGTCATTGATGACACCAATATCACACGACTGCAGCTGGAGACAGAGATCGAGGCTCTCAAGGAGGAGCTGCTCTTCATGAAGAAGAACCACGAAGAGGAAGTAAAAGGCCTACAAGCCCAGATTGCCAGCTCTGGGTTGACCGTGGAGGTAGATGCCCCCAAATCTCAGGACCTCGCCAAGATCATGGCAGACATCCGGGCCCAATATGACGAGCTGGCTCGGAAGAACCGAGAGGAGCTAGACAAGTACTGGTCTCAGCAGATTGAGGAGAGCACCACAGTGGTCACCACACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGAGACCAATGACACCAAAGTTCTGAGGCATTAAGCCAGCAGAAGCAGGGTACCCTTTGGGGAGCAGGAGGCCAATAAAAAGTTCAGAG