Transcript asmbl_12246

Sequence
Transcript Sequence for observation asmbl_12246 of TGE0003057:
CCCCTTAACACCTTCCCCCAGGTGGTGAGGGGCCAAAGCTCGGGGATGGACAAGAGAAAGGAAGGAGATGTCACTGCTGAATTTCTGCTGAATTTCCTTCTGCCTGCTGCCCGATTTCTATTTGACTGGCAATAGTCTGAGGAGGACCTATTAGAGCCTTTGCCCCGGCGTCGGTGACTCAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCGAGGTCCGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCGGCGCACTCCGACTCCGAGCAGTCTCTGTCCTTCGACCCGAGCCCCGCGCCCTTTCCGGGACCCCTGCCCCGCGGGCAGCGCTGCCAACCTGCCGGCCATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGGCCAGCTCCACTCCGCTGTCGCCCACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGATCGCTTGGCGGTCTACATCGACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGCCTTCGCATCACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTTTAAGGAGCTGAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTATAAGAAGGAGCTGGAGAAGACTTATTCTGCCAAGCTGGACAATGCCAGGCAGTCTGCTGAGAGGAACAGCAACCTGGTGGGGGCTGCCCACGAGGAGCTGCAGCAGTCGCGCATCCGCATCGACAGCCTCTCTGCCCAGCTCAGCCAGCTCCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTTCGAGACCTGGAGGACTCACTGGCCCGTGAGCGGGACACCAGCCGGCGGCTGCTGGCGGAAAAGGAGCGGGAGATGGCCGAGATGCGGGCAAGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTTCTGGACATCAAGCTGGCCCTGGACATGGAGATCCACGCCTACCGCAAGCTCTTGGAGGGCGAGGAGGAGAGGCTACGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGCCGTGCTTCCTCTCACTCATCCCAGACACAGGGTGGGGGCAGCGTCACCAAAAAGCGCAAACTGGAGTCCACTGAGAGCCGCAGCAGCTTCTCACAGCACGCACGCACTAGCGGGCGCGTGGCCGTGGAGGAGGTGGATGAGGAGGGCAAGTTTGTCCGGCTGCGCAACAAGTCCAATGAGGACCAGTCCATGGGCAATTGGCAGATCAAGCGCCAGAATGGAGATGATCCCTTGCTGACTTACCGGTTCCCACCAAAGTTCACCCTGAAGGCTGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCTACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGCGGGAACAGCCTGCGTACGGCTCTCATCAACTCCACTGGGGAAGAAGTGGCCATGCGCAAGCTGGTGCGCTCAGTGACTGTGGTTGAGGACGACGAGGATGAGGATGGAGATGACCTGCTCCATCACCACCACGTGAGTGGTAGCCGCCGCTGAGGCCGAGCCTGCACTGGGGCCACCCAGCCAGGCCTGGGGGCAGCCTCTCCCCAGCCTCCCCGTGCCAAAAATCTTTTCATTAAAGAATGTTTTGGAACTTTACTCGCTGGCCTGGCCTTTCTTCTCTCTCCTCCCTATACCTTGAACAGGGAACCCAGGTGTCTGGGTGCCCTACTCTGGTAAGGAAGGGAGTGGGAACTTTCTGATGCCATGGAATATTCCTGTGGGAGCAGTGGACAAGGGTCTGGATTTGTCTTCTGGGAAAGGGAGGGGAGGACAGACGTGGGGCATGCCCGCCCTGCCTCTCTCCCCCATTCTTGTTGCATGCATATCCTCTCATTTCCCTCATTTTTCCTGCAAGAATGTTCTCTCTCATTCCTGACCGCCCCTCCACTCCAATTAATAGTGCATGCCTGCTGCCCTACAAGCTTGCTCCCGTTCTCTCTTCTTTTCCTCTTAAGCTCAGAGTAGCTAGAACAGAGTCAGAGTCACTGCTCTGGTTCTCTGTCCCCAAGTCTTCCTGAGCCTTCTCCCCTTTTATGTCTTCCCTCTCCTCCTCCGGGCCCCTAGCCTCCCAAACCCCCATTGCCCGCTGGCTCCTTGGGCACAGAACCACACCTTCCTGCCTGGCGGCTGGGAGCCTGCAGGAGCCTGGAGCCTGGTTGGGCCTGAGTGGTCAGTCCCAGACTCGCCGTCCCGCCTGAGCCTTGTCTCCCTTCCCAGGGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTACAACCTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGACAAGGCATCTGCCAGCGGCTCAGGAGCCCAGGTGGGCGGACCCATCTCCTCTGGCTCTTCTGCCTCCAGTGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAATCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAACCCAGGTGAGTTGTCTCTGCTTTGTCTCCAAATCCTGCAGGCGGGTCCCTGGTCATCGAGGGGTAGGACGAGGTGGCCTTGCAGGGGGGAGAGCCTGCCTTCTCTTCCGCAGCCCGGGGGAGTGGGAGCCTCCTCCCCACAGCCTGAGTCCTAGACAGCCCACCTCTGCATCCTGCCCCTCTTGTCTGAGCCCCAGACTGGAGGGCAGGGGCAGGGCTGGAGTGTGAGGGATGGGGGAGATGCTACCTCCCTTCTAGGGGCCAGGGGAGGGAGGGTCTGGGTCCAGGCCCTGCTGCTCACACCTCTCTCCTCTGTTTTCTCTCTTAGAGCCCCCAGAACTGCAGCATC