Transcript asmbl_102773

Sequence
Transcript Sequence for observation asmbl_102773 of TGE0056398:
GAAGGGCGCACCTGCCGGGATAACAGGCCAGATGAAGTAAATAGAAAATCCTCTGAGCTCCCCTACTGGCTCCAGCTGTGGAGAAGGGGGAGGAGAAAACCCTGTGGGACAGGGGAGGAGGGTGAGGGCTCCTCTTAGGAAGTTATTTAAGAGCCAACTGTCTTGTCTTTCCCGAGTCCGTTTGAGGAAGTCCCCGAGGCGCACAGAGCAAGCCCACGCGAGGGCACCTCTGGAGGGGAGCGCCTGCAGGACCTTGTAAAGTCAAAAATGTCAGAAACTTCCAGGACCGCCTTTGGAGGCAGAAGAGCAGTTCCACCCAATAACTCTAATGCAGCGGAAGATGACCTGCCCACAGTGGAGCTTCAGGGCGTGGTGCCCCGGGGCGTCAACCTGCAAGAGTTTCTTAATGTCACGAGCGTTCACCTGTTCAAGGAGAGATGGGACACTAACAAGGTGGACCACCACACTGACAAGTATGAAAACAACAAGCTGATTGTCCGCAGAGGGCAGTCTTTCTATGTGCAGATTGACTTCAGTCGTCCATATGACCCCAGAAGGGATCTCTTCAGGGTGGAATACGTCATTGGTCGCTACCCACAGGAGAACAAGGGAACCTACATCCCAGTGCCTATAGTCTCAGAGTTACAAAGTGGAAAGTGGGGGGCCAAGATTGTCATGAGAGAGGACAGGTCTGTGCGGCTGTCCATCCAGTCTTCCCCCAAATGTATTGTGGGGAAATTCCGCATGTATGTTGCTGTCTGGACTCCCTATGGCGTACTTCGAACCAGTCGAAACCCAGAAACAGACACGTACATTCTCTTCAATCCTTGGTGTGAAGATGATGCTGTGTATCTGGACAATGAGAAAGAAAGAGAAGAGTATGTCCTGAATGACATCGGGGTAATTTTTTATGGAGAGGTCAATGACATCAAGACCAGAAGCTGGAGCTATGGTCAGTTTGAAGATGGCATCCTGGACACTTGCCTGTATGTGATGGACAGAGCACAAATGGACCTCTCTGGAAGAGGGAATCCCATCAAAGTCAGCCGTGTGGGGTCTGCAATGGTGAATGCCAAAGATGACGAAGGTGTCCTCGTTGGATCCTGGGACAATATCTATGCCTATGGCGTCCCCCCATCGGCCTGGACTGGAAGCGTTGACATTCTATTGGAATACCGGAGCTCTGAGAATCCAGTCCGGTATGGCCAATGCTGGGTTTTTGCTGGTGTCTTTAACACATTTTTACGATGCCTTGGAATACCAGCAAGAATTGTTACCAATTATTTCTCTGCCCATGATAATGATGCCAATTTGCAAATGGACATCTTCCTGGAAGAAGATGGGAACGTGAATTCCAAACTCACCAAGGATTCAGTGTGGAACTACCACTGCTGGAATGAAGCATGGATGACAAGGCCTGACCTTCCTGTTGGATTTGGAGGCTGGCAAGCTGTGGACAGCACCCCCCAGGAAAATAGCGATGGCATGTATCGGTGTGGCCCCGCCTCGGTTCAAGCCATCAAGCACGGCCATGTCTGCTTCCAATTTGATGCACCTTTTGTTTTTGCAGAGGTCAACAGCGACCTCATTTACATTACAGCTAAGAAAGATGGCACTCATGTGGTGGAAAATGTGGATGCCACCCACATTGGGAAATTAATTGTGACCAAACAAATTGGAGGAGATGGCATGATGGATATTACTGATACTTACAAATTCCAAGAAGGTCAAGAAGAAGAGAGATTGGCCCTAGAAACTGCCCTGATGTACGGAGCTAAAAAGCCCCTCAACACAGAAGGTGTCATGAAATCAAGGTCCAACGTTGACATGGACTTTGAAGTGGAAAATGCTGTGCTGGGAAAAGACTTCAAGCTCTCCATCACCTTCCGGAACAACAGCCACAACCGTTACACCATCACAGCTTATCTCTCAGCCAACATCACCTTCTACACCGGGGTCCCGAAGGCAGAATTCAAGAAGGAGACGTTCGACGTGACGCTGGAGCCCTTGTCCTTCAAGAAAGAGGCGGTGCTGATCCAAGCCGGCGAGTACATGGGTCAGCTGCTGGAACAAGCGTCCCTGCACTTCTTTGTCACAGCTCGCATCAATGAGACCAGGGATGTTCTGGCCAAGCAAAAGTCCACCGTGCTAACCATCCCTGAGATCATCATCAAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTTTACCAATCCTTTAAAAGAAACCCTGCGAAATGTCTGGGTACACCTGGATGGTCCTGGAGTAACAAGACCAATGAAGAAGATGTTCCGTGAAATCCGGCCCAACTCCACCGTGCAGTGGGAAGAAGTGTGCCGGCCCTGGGTCTCTGGGCATCGGAAGCTGATAGCCAGCATGAGCAGTGACTCCCTGAGACATGTGTATGGCGAGCTGGACGTGCAGATTCAAAGACGACCTTCCATGTGAATGCACAGGAAGCTGAGATGAACCCTGGCATTTGGCCTCTTGTAGTCTTGGCTAAGGAAATTCTAACGCAAAAATAGCTCTTGCTTTGACTTAGGTGTGAAGACCCAGACAGGACTGCAGAGGGCTCCAGAGTGGAGATCCCACATATTTCAAAAACATGCTTTTCCAAACCCAGGCTATTCGGCAAGGAAGTTAGTTTTTAATCTCTCCACCTTCCAAAGAGTGCTAAGCATTAGCTTTAATTAAGCTCTCATAGCTCATAAGAGTAACAGTCATCATTTATCATCACAAATGGCTACATCTCCAAATATCAGTGGGCTCTCTTACCAGGGAGATTTGCTCAATACCTGGCCTCATTTAAAACAAGACTTCAGATTCCCCACTCAGCCTTTTGGGAATAATAGCACATGATTTGGGCTCTAGAATTCCAGTCCCCTTTCTCGGGGTCAGGTTCTACCCTCCATGTGAGAATATTTTTCCCAGGACTAGAGCACAACATAATTTTTATTTTTGGCAAAGCCAGAAAAAGATCTTTCATTTTGCACCTGCAGCCAAGCAAATGCCTGCCAAATTTTAGATTTACCTTGTTAGAAGAGGTGGCCCCATATTAACAAATTGCATTTGTGGGAAACTTAACCACCTACAAGGAGATAAGAAAGCAGGTGCAACACTCAAGTCTATTGAATAATGTAGTTTTGTGATGCATTTTATAGAATGTGTCACACTGTGGCCTGATCAGCAGGAGCCAATATCCCTTACTTTAACCCTTTCTGGGATGCAATACTAGGAAGTAAAGTGAAGAATTTATCTCTTTAGTTAGTGATTATATTTCACCCATCTCTCAGGAATCATCTCCTTTGCAGAATGATGCAGGTTCAGGTCCCCTTTCAGAGATATAATAAGCCCAACAAGTTGAAGAAGCTGGCGGATCTAGTGACCAGATATATAGAAGGACTGCAGCCACTGATTCTCTCTTGTCCTTCACATCACCCATGTTGAGACCTCAGCTTGGCACTCAGGTGCTGAAGGGTAATATGGACTCAGCCTTGCAAATAGCCAGTGCTAGTTCTGACCCAACCACAGAGGATGCTGACATCATTTGTATTATGTTCCAAGGCTACTACAGAGAAGGCTGCCTGCTATGTATTTGCAAGGCTGATTTATGGTCAGAATTTCCCTCTGATATGTCTAGGGTGTGATTTAGGTCAGTAGACTGTGATTCTTAGCAAAAAATGAACAGTGATAAGTATACTGGGGGCAAAATCAGAATGGAATGCTCTGGTCTATATAACCACATTTCTAAGCCTTTGAGACTGTTCCTGAGCCTTCAGCACTAACCTATGAGGGTGAGCTGGTCCCCTCTATATATACATCATACTTAACTTTACTAAGTAATCTCACAGCATTTGCCAAGTCTCCCAATATCCAATTTTAAAATGAAATGCATTTTGCTAGACAGTTAAACTGGCTTAACTTAGTATATTATTATTAATTACAATGTAATAGAAGCTTAAAATAAAGTTAAACTGATTATATTTGC