Transcript asmbl_102119

Sequence
Transcript Sequence for observation asmbl_102119 of TGE0002270:
CGTGCAGCCTGAGAGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGTCACCCTCGTCTTGCATTTTCCCGCGTGCGTGTGTGAGTGGGTGTGTGTGTTTTCTTACAAAGGGTATTTCGCGATCGATCGATTGATTCGTAGTTCCCCCCCGCGCGCCTTTGCCCTTTGTGCTGTAATCGAGCTCCCGCCATCCCAGGTGCTTCTCCGTTCCTCTAAACGCCAGCGTCTGGACGTGAGCGCAGGTCGCCGGTTTGTGCCTTCGGTCCCCGCTTCGCCCCCTGCCGTCCCCTCCTTATCACGGTCCCGCTCGCGGCCTCGCCGCCCCGCTGTCTCCGCCGCCCGCCATGGCGACTGCGACCCCCGTGCCGCCGCGGATGGGCAGCCGCGCTGGCGGCCCCACCACGCCGCTGAGCCCCACGCGCCTGTCGCGGCTCCAGGAGAAGGAGGAGCTGCGCGAGCTCAATGACCGGCTGGCGGTGTACATCGACAAGGTGCGCAGCCTGGAGACGGAGAACAGCGCGCTGCAGCTGCAGGTGACGGAGCGCGAGGAGGTGCGCGGCCGTGAGCTCACCGGCCTCAAGGCGCTCTACGAGACCGAGCTGGCCGACGCGCGACGCGCGCTCGACGACACGGCCCGCGAGCGCGCCAAGCTGCAGATCGAGCTGGGCAAGTGCAAGGCGGAACACGACCAGCTGCTCCTCAACTATGCTAAGAAGGAATCTGATCTTAATGGCGCCCAGATCAAGCTTCGAGAATATGAAGCAGCACTGAATTCGAAAGATGCAGCTCTTGCTACTGCACTTGGTGACAAAAAAAGTTTAGAGGGAGATTTGGAGGATCTGAAGGATCAGATTGCCCAGTTGGAAGCCTCCTTAGCTGCAGCCAAAAAACAGTTAGCAGATGAAACTTTACTTAAAGTAGATTTGGAGAATCGTTGTCAGAGCCTTACTGAGGACTTGGAGTTTCGCAAAAGCATGTATGAAGAGGAGATTAACGAGACCAGAAGGAAGCATGAAACGCGCTTGGTAGAGGTGGATTCTGGGCGTCAAATTGAGTATGAGTACAAGCTGGCGCAAGCCCTTCATGAGATGAGAGAGCAACATGATGCCCAAGTGAGGCTGTATAAGGAGGAGCTGGAGCAGACTTACCATGCCAAACTTGAGAATGCCAGACTGTCATCAGAGATGAATACTTCTACTGTCAACAGTGCCAGGGAAGAACTGATGGAAAGCCGCATGAGAATTGAGAGCCTTTCATCCCAGCTTTCTAATCTACAGAAAGAGTCTAGAGCATGTTTGGAAAGGATTCAAGAATTAGAGGACTTGCTTGCTAAAGAAAAAGACAACTCTCGTCGCATGCTGACAGACAAAGAGAGAGAGATGGCGGAAATAAGGGATCAAATGCAGCAACAGCTGAATGACTATGAACAGCTTCTTGATGTAAAGTTAGCCCTGGACATGGAAATCAGTGCTTACAGGAAACTCTTAGAAGGCGAAGAAGAGAGGTTGAAGCTGTCTCCAAGCCCTTCTTCCCGTGTGACAGTATCCCGAGCATCCTCAAGTCGTAGTGTACGTACAACTAGAGGAAAGCGGAAGAGGGTTGATGTGGAAGAATCAGAGGCGAGTAGTAGTGTTAGCATCTCTCATTCCGCCTCAGCCACTGGAAATGTTTGCATCGAAGAAATTGATGTTGATGGGAAATTTATCCGCTTGAAGAACACTTCTGAACAGGATCAACCAATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGTTATAAATATACCTCAAGATATGTGCTGAAGGCAGGCCAGACTGTTACAATTTGGGCTGCAAACGCTGGTGTCACAGCCAGCCCCCCAACTGACCTCATCTGGAAGAACCAGAACTCGTGGGGCACTGGCGAAGATGTGAAGGTTATATTGAAAAATTCTCAGGGAGAGGAGGTTGCTCAAAGAAGTACAGTCTTTAAAACAACCATACCTGAAGAAGAGGAGGAGGAGGAAGAAGCAGCTGGAGTGGTTGTTGAGGAAGAACTTTTCCACCAGCAGGGAACCCCAAGAGCATCCAATAGAAGCTGTGCAATTATGTAAAATTTTCAACTGTCTTCCTCAAAATAAAGAAGTATGGTAATCTTTACCTGTATACAGTGCAGAGCCTTCTCAGAAGCACAGAATATTTTTATATTTCCTTTATGTGAATTTTTAAGCTGCAAATCTGATGGCCTTAATTTCCTTTTTGACACTGAAAGTTTTGTAAAAGAAATCATGTCCATACACTTTGTTGCAAGATGTGAATTATTGACACTGAACTTAATAACTGTGTACTGTTCGGAAGGGGTTCCTCAAATTTTTTGACTTTTTTTGTATGTGTGTTTTTTCTTTTTTTTTAAGTTCTTATGAGGAGGGGAGGGTAAATAAACCACTGTGCGTCTTGGTGTAATTTGAAGATTGCCCCATCTAGACTAGCAATCTCTTCATTATTCTCTGCTATATATAAAACGGTGCTGTGAGGGAGGGGAAAAGCATTTTTCAATATATTGAACTTTTGTACTGAATTTTTTTGTAATAAGCAATCAAGGTTATAATTTTTTTTAAAATAGAAATTTTGTAAGAAGGCAATATTAACCTAATCACCATGTAAGCACTCTGGATGATGGATTCCACAAAACTTGGTTTTATGGTTACTTCTTCTCTTAGATTCTTAATTCATGAGGA