Transcript asmbl_97987

Sequence
Transcript Sequence for observation asmbl_97987 of TGE0058224:
GGACCTGGCCGAGCAGGAGGCGCCATCATGGGAGTGGACATCCGCCATAACAAGGACCGAAAGGTTCGGCGCAAGGAGCCCAAGAGCCAGGATATCTACCTGAGGCTGTTGGTCAAGTTATACAGGTTTCTGGCCAGAAGAACCAACTCCACATTCAACCAGGTTGTGTTGAAGAGGTTGTTTATGAGTCGCACCAACCGGCCGCCTCTGTCCCTTTCCCGGATGATCCGGAAGATGAAGCTTCCTGGCCGGGAAAACAAGACGGCCGTGGTTGTGGGGACCATAACTGATGATGTGCGGGTTCAGGAGGTACCCAAACTGAAGGTATGTGCACTGCGCGTGACCAGCCGGGCCCGCAGCCGCATCCTCAGGGCAGGGGGCAAGATCCTCACTTTCGACCAGCTGGCCCTGGACTCCCCTAAGGGCTGTGGCACTGTCCTGCTCTCCGGTCCTCGCAAGGGCCGAGAGGTGTACCGGCATTTCGGCAAGGCCCCAGGAACCCCGCACAGCCACACCAAACCCTACGTCCGCTCCAAGGGCCGGAAGTTCGAGCGTGCCAGAGGCCGACGGGCCAGCCGAGGCTACAAAAACTAACCCTGGATCCTACTCTCTTATTAAAAAGATTTTTGCTGAC