Transcript asmbl_24872

Sequence
Transcript Sequence for observation asmbl_24872 of TGE0004413:
CAGCTTAGTGCTCCAGCCCCCGCCTCCTGCAGCAGCCCGGTGGGGGGTGGGGAGGCGGGACCGGGTGGCGAGGTTGTGGTCTCAGGGCCGGGCGTGGAGCTGACATTATGTACGTCCTGGCCCACTGTGCCAGCTCGGTACCTGTCCGGGCAGTTGCCATCCATTGTGCGACAGCGGCGGCAGCCAGAGCGTACCTGGAAGGAGGTCTACAGTGGACGCTTGGCAAGGCCCGCGGTTTCAGAAGCGCCGCTGCAGCTATGGCCCCGATCAAGGTGGGAGATACCATCCCGTCTGTGGTGGTGTTCGAAGGGAAGCCTGAGAACAAAGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAGGGGGTGCTTTTTGGAGTCCCTGGGGCCTTTACCCCCGGTTGTTCCAAGACCCACCTGCCAGGGTTTGTGAATCAGTCTGGGGCTCTGAAGGCCAAGGGGGTCCAGGTGGTGGCATGTCTGAGTGTTAACGATGTCTTCGTGACTGAAGAGTGGGGACGAGCCCATAATGCAGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACGGATTTGTTGCTAGATGATTCATTGGTGCCCCTCTTTGGGAATCGACGGCTCAAGAGGTTCTCCATGGTGATCGAAGATGGTGTAGTGAAGGCTCTGAACGTGGAGCCGGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCGCAGCTCTGAGGCCCTGGGCCCAGATACACTCCTACCCTTTTTTGTTTCACCTGCCCAGCTAAAGGCAGAGGGCCCCAGCCCAGCCTCAGCTAGGGCCACCCGATTGGAACTTTGGCTAGATTTCTTCAATAAACACTTTTGGTTCA