Transcript asmbl_95984

Sequence
Transcript Sequence for observation asmbl_95984 of TGE0006294:
GCCTTCCGGTGCGCCTTCCGCTCCGCCCCTTCAGGCAGGAAGTGTCGGCGCCGCCACTGTCCGGCCACAGCCTAACGCTCTTCGCTGTCGTTTGTGGTCTCGCGCAGGGCGGCCCCGGTTCTGGTGTTTGGCGTCGGAATTAAACAACCACCATGTCGAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCCATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGCTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCCACTGATGCATACCTTGATGCCATGATGAATGAGGCCCCAGGGCCCATCAATTTCACCATGTTCCTGACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAACGCCTTTGCTTGCTTTGATGAAGAAGCAACAGGCACCATTCAGGAAGATTACCTAAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAAGAACTTTAGCTAAAATCTTCCAGTTACATTGTCTTACTCTCTTTTACTTCTCAGACACTTCCCCCACCCTCATAGAACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTCTTTTTGATGTATTTATTCCAGACCTTTCTGCCACTTAGCACTTGTATAATCAGACTGGAAATGGGGATGAGGGTGTAAATTGTATTGAAAAAGATCGCGAATAAAAATCAACAAATGTGAAAGCCCAGAAAAATATATTCGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGTTATTTTGAAATAAAGATTATGCTGACTCAAATGCAATGTAATGGCAAGTTAAACAAATGATTGATAGGTGGGGGTAGTCCTTTTTTCAGGTTTTCAACTTCATATGATTCAGGTTTTATGGTAAAATTGATTTTTC