Transcript asmbl_95982

Sequence
Transcript Sequence for observation asmbl_95982 of TGE0000954:
GCCTTTCAACAAATAGTTTTTTTGAACTACTTTTGCCTAGTGGTGAGGGTACAATAAAAAATGTTAGTTGAAAGTGAAAGCTTTAACAATATTTGTCAATAGAGATTAGGAGATGAAGACCTGTTCCATCAGTTAGTCATTCTTACTATTCTTCACCTTTCTGTCCACCGTACTATGGAATAGCCAGTTTAGGCTAAGGCTGCAAAGCAGGGACCTACTGAAGATGAATTAGTATCCCTCAGCACCCCTATACTGCTGAAGTATAGAACTTGGGAGTTTCCTAAGTACCTAATTTTTTTTGCTTCTTGGTTTTTTATTGTTATCAAATCAGCAGATTTGGTTATCAGCTGTTGTTAGTTATATAGCAGTACAGGACATATGTAATCTTGTTGAGATGTGTCTTCTAAAGACACATTTCTGAGTAGCTCAAACATATCAGGAAAGTTGGTTCTGTGTACTTTTGTTAATCATTGTTTTGATTCAAACTTAAGTAATCTTAGATGTTGATTTGGTTTTTATTGTATTTCCTTTCCTAATTAGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCAACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAATAACTTCAAATTCCAGCCAAACGTTCCTTGTTGCCACTTTGGGTATTCTGAGATTTTCTCTTGCATGCCCTTAGCTTTACAGCTTTTGCATTTCCTGTTGTATTTATTCTCAGCCATTTTGGGCATATGTATCTTTATAATCAGACTGGAAACGGGACTTTCTATTAATATCATTTTCAGAATAAAAAATAGGATAATTTAACCTACCAGCCCTTCTCCCCCAATAACTGTGGTCTATACAGAGTCAATATATTTTTTCAGAGAAAGTTATTCGCTCGATTTTTTCTGAATCATAATTAAACTTTATGATAAAATA