Transcript asmbl_91473

Sequence
Transcript Sequence for observation asmbl_91473 of TGE0057043:
GGGAGTTTCTCCTCGGGGTCGGAGCAGGAGGCACGCGGAGTGTGAGGCCACGCATGAGCGGACGCTAACCCCCTCCCCAGCCACAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACGCACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACATCCCACCAATCACCTGCGTACAGAACGGCCTCAGGTACCATGACCGAGACGTGTGGAAACCCGAGCCCTGCCGGATCTGCGTCTGCGACAACGGCAAGGTGTTGTGCGATGACGTGATCTGTGACGAGACCAAGAACTGCCCCGGCGCCGAAGTCCCCGAGGGCGAGTGCTGTCCCGTCTGCCCCGACGGCTCAGAGTCACCCACCGACCAAGAAACCACCGGCGTCGAGGGACCCAAGGGAGACACTGGCCCCCGAGGCCCAAGGGGACCCGCAGGCCCCCCTGGCCGAGATGGCATCCCTGGACAGCCTGGACTTCCCGGACCCCCCGGACCCCCCGGACCTCCCGGACCCCCTGGCCTCGGAGGAAACTTTGCTCCCCAGCTGTCTTATGGCTATGATGAGAAATCAACCGGAGGAATTTCCGTGCCTGGCCCCATGGGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCTGGTCCCCAAGGCTTCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGTCCCATGGGTCCCCGAGGTCCCCCAGGTCCCCCTGGAAAGAATGGAGATGATGGGGAAGCTGGAAAACCTGGTCGTCCTGGTGAGCGTGGGCCTCCTGGGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCCTCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAGGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCAGCCCTGGTGAAAATGGAGCTCCTGGTCAGATGGGCCCCCGTGGCCTGCCTGGTGAGAGAGGTCGCCCTGGAGCCCCTGGCCCTGCTGGTGCTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCTGGTCCCACCGGCCCCGCTGGTCCTCCTGGCTTCCCTGGTGCTGTTGGTGCTAAGGGTGAAGCTGGTCCCCAAGGGCCCCGAGGCTCTGAAGGTCCCCAGGGTGTGCGTGGTGAGCCTGGCCCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGGAAACCCTGGTGCTGATGGACAGCCTGGTGCTAAAGGTGCCAATGGTGCTCCTGGTATTGCTGGTGCTCCTGGCTTCCCTGGTGCCCGAGGCCCCTCTGGACCCCAGGGCCCCGGCGGCCCTCCTGGTCCCAAGGGTAACAGCGGTGAACCTGGTGCTCCTGGCAGCAAAGGAGACACTGGTGCTAAGGGAGAGCCTGGCCCTGTTGGTGTTCAAGGACCCCCTGGCCCTGCTGGAGAGGAAGGAAAGCGAGGAGCTCGAGGTGAACCCGGACCCACTGGCCTGCCCGGACCCCCTGGCGAGCGTGGTGGACCTGGTAGCCGTGGTTTCCCTGGCGCAGATGGTGTTGCTGGTCCCAAGGGTCCCGCTGGTGAACGTGGTTCTCCTGGCCCTGCTGGCCCCAAAGGATCTCCTGGTGAAGCTGGTCGTCCCGGTGAAGCTGGTCTGCCTGGTGCCAAGGGTCTGACTGGAAGCCCTGGCAGCCCTGGTCCTGATGGCAAAACTGGCCCCCCTGTAAGTATCACTCCCCCTGAACCCCCTGCCATTGTCCTGTCTGCCTCCCTGCTGTCCTCACTGCTGCTTTCGTGCCTCCCATCCTTAGGGTCCCGCCGGTCAAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTGCTGGAGAGCCCGGCAAGGCTGGAGAGCGAGGTGTTCCCGGACCCCCTGGCGCTGTCGGTCCTGCTGGCAAAGATGGAGAGGCTGGAGCTCAGGGACCCCCTGGCCCTGCTGGTCCCGCTGGCGAGAGAGGTGAACAAGGCCCTGCTGGCTCCCCCGGATTCCAGGGTCTCCCTGGTCCTGCTGGTCCTCCAGGTGAAGCAGGCAAACCTGGTGAACAGGGTGTTCCTGGAGACCTTGGCGCCCCTGGCCCCTCTGGAGCAAGAGGCGAGAGAGGTTTCCCTGGCGAGCGTGGTGTGCAAGGTCCCCCTGGTCCTGCTGGTCCCCGAGGGGCCAACGGTGCTCCCGGCAACGATGGTGCTAAGGGTGATGCTGGTGCCCCTGGAGCTCCCGGTAGCCAGGGCGCCCCTGGCCTTCAGGGAATGCCTGGTGAACGTGGTGCAGCTGGTCTTCCAGGGCCTAAGGGTGACAGAGGTGATGCTGGTCCCAAAGGTGCTGATGGCTCTCCTGGCAAAGATGGCGTCCGTGGTCTGACTGGCCCCATTGGTCCTCCTGGCCCTGCTGGTGCCCCTGGTGACAAGGGTGAAAGTGGTCCCAGCGGCCCTGCTGGTCCCACTGGAGCTCGTGGTGCCCCCGGAGACCGTGGTGAGCCTGGTCCCCCCGGCCCTGCTGGCTTTGCTGGCCCCCCTGGTGCTGACGGCCAACCTGGTGCTAAAGGCGAACCTGGTGATGCTGGTGCTAAAGGCGATGCTGGTCCCCCTGGCCCTGCCGGACCCGCTGGACCCCCTGGCCCCATTGGTAATGTTGGTGCTCCTGGAGCCAAAGGTGCTCGCGGCAGCGCTGGTCCCCCTGGTGCTACTGGTTTCCCTGGTGCTGCTGGCCGAGTCGGTCCTCCTGGCCCCTCTGGAAATGCTGGACCCCCTGGCCCTCCTGGTCCTGCTGGCAAAGAAGGCGGCAAAGGTCCCCGTGGTGAGACTGGCCCTGCTGGACGTCCTGGTGAAGTTGGTCCCCCTGGTCCCCCTGGCCCTGCTGGCGAGAAAGGATCCCCTGGTGCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGACAGCGTGGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCCTGGTCTTCCTGGCCCCTCTGGTGAACCTGGCAAACAAGGTCCCTCTGGAGCAAGTGGTGAACGTGGTCCCCCTGGTCCCATGGGCCCCCCTGGATTGGCTGGACCCCCTGGTGAATCTGGACGTGAGGGGGCTCCTGGTGCCGAAGGTTCCCCTGGACGAGACGGTTCTCCTGGCGCCAAGGGTGACCGTGGTGAGACCGGCCCCGCTGGACCCCCTGGTGCTCCTGGTGCTCCTGGTGCCCCTGGCCCCGTTGGCCCTGCTGGCAAGAGTGGTGATCGTGGTGAGACTGGTCCTGCTGGTCCCGCCGGTCCTGTCGGCCCTGTTGGCGCCCGTGGCCCCGCCGGACCCCAAGGCCCCCGTGGTGACAAGGGTGAGACAGGCGAACAGGGCGACAGAGGCATAAAGGGTCACCGTGGCTTCTCTGGCCTCCAGGGTCCCCCTGGCCCTCCTGGCTCTCCTGGTGAACAAGGTCCCTCTGGAGCCTCTGGTCCTGCTGGTCCCCGAGGTCCCCCTGGCTCTGCTGGTGCTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGCCCCATTGGGCCCCCTGGTCCTCGCGGTCGCACTGGTGATGCTGGTCCTGTTGGTCCCCCCGGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTCAGCTTCCTGCCCCAGCCACCTCAAGAGAAGGCTCACGATGGTGGCCGCTACTACCGGGCTGATGATGCCAATGTGGTTCGTGACCGTGACCTCGAGGTGGACACCACCCTCAAGAGCCTGAGCCAGCAGATCGAGAACATCCGGAGCCCAGAGGGCAGCCGCAAGAACCCCGCCCGCACCTGCCGTGACCTCAAGATGTGCCACTCTGACTGGAAGAGTGGAGAGTACTGGATTGACCCCAACCAAGGCTGCAACCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTCAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATGTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCGACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCCAGAACATCACCTACCACTGCAAGAACAGCGTGGCCTACATGGACCAGCAGACTGGCAACCTCAAGAAGGCCCTGCTCCTCCAGGGCTCCAACGAGATCGAGATCCGCGCCGAGGGCAACAGCCGCTTCACCTACAGCGTCACTGTCGATGGCTGCACGAGTCACACCGGAGCCTGGGGCAAGACAGTGATTGAATACAAAACCACCAAGACCTCCCGCCTGCCCATCATCGATGTGGCCCCCTTGGACGTTGGTGCCCCAGACCAGGAATTCGGCTTCGACGTTGGCCCTGTCTGCTTCCTGTAAACTCCCTCCATCCCAACCTGGCTCCCTCCCACCCAACCAACTTTCCCCCCAACCCGGAAACAGACAAGCAACCCAAACTGAACCCCCTCAAAAGCCAAAAAATGGGAGACAATTTCACATGGACTTTGGAAAATATTTTTTTCCTTTGCATTCATCTCTCAAACTTAGTTTTTATCTTTGACCAACCGAACATGACCAAAAACCAAAAGTGCATTCAACCTTACC