Transcript asmbl_81094

Sequence
Transcript Sequence for observation asmbl_81094 of TGE0058311:
CAGATCGCTGACCTCCAGGCGCAGATCGCAGAGCTCAAGATGCAGCTGGCCAAGAAGGAGGAGGAGCTGCAGGCGGCCCTGGCCAGGCTTGACGATGAAATCGCTCAGAAGAACAATGCCCTGAAGAAGATCCGGGAGCTGGAGGGCCACATCTCAGACCTCCAGGAGGACCTGGACTCAGAGCGGGCCGCCAGGAACAAGGCTGAAAAGCAGAAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGACACACTGGACAGCACAGCCACTCAGCAGGAGCTCAGGGCCAAGAGGGAGCAGGAGGTGACGGTGCTGAAGAAGGCCCTGGATGAAGAGACGCGGTCCCATGAGGCTCAGGTCCAGGAGATGAGGCAGAAACACGCACAGGCGGTGGAGGAGCTCACAGAGCAGCTTGAGCAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAGCAGACGCTGGAGAAAGAGAACGCAGACCTGGCCGGGGAGCTGCGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGCAGTCCAAGTGCAGCGATGGGGAGCGGGCCCGGGCGGAGCTCAATGACAAAGTCCACAAGCTGCAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTACGAAGCTGCGCCAGCTGGAGGAGGAGCGGAACAGCCTGCAAGACCAGCTGGACGAGGAGATGGAGGCCAAGCAGAACCTGGAGCGCCACATCTCCACTCTCAACATCCAGCTCTCCGACTCGAAGAAGAAGCTGCAGGACTTTGCCAGCACCGTGGAAGCTCTGGAAGAGGGGAAGAAGAGGTTCCAGAAGGAGATCGAGAACCTCACCCAGCAGTACGAGGAGAAGGCGGCCGCTTATGATAAACTGGAAAAGACCAAGAACAGGCTTCAGCAGGAGCTGGACGACCTGGTTGTTGATTTGGACAACCAGCGGCAACTCGTGTCCAACCTGGAAAAGAAGCAGAGGAAATTTGATCAGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATGAGAGGGACAGAGCTGAGGCAGAAGCCAGGGAGAAGGAAACCAAGGCCCTGTCCCTGGCTCGGGCCCTTGAAGAGGCCTTGGAAGCCAAAGAGGAACTCGAGCGGACCAACAAAATGCTCAAAGCCGAAATGGAAGACCTGGTCAGCTCCAAGGATGACGTGGGCAAGAACGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACGCAGCTGGAAGAGCTGGAGGACGAGCTGCAAGCCACGGAGGACGCCAAACTGCGGCTGGAAGTCAACATGCAGGCGCTCAAGGGCCAGTTCGAAAGGGATCTCCAAGCCCGGGACGAGCAGAATGAGGAGAAGAGGAGGCAACTGCAGAGACAGCTTCACGAGTATGAGACGGAACTGGAAGACGAGCGAAAGCAACGTGCCCTGGCAGCTGCAGCAAAGAAGAAGCTGGAAGGGGACCTGAAAGACCTGGAGCTTCAGGCCGACTCTGCCATCAAGGGGAGGGAGGAAGCCATCAAGCAGCTACGCAAACTGCAGGCTCAGATGAAGGACTTTCAAAGAGAGCTGGAAGATGCCCGTGCCTCCAGAGATGAGATCTTTGCCACAGCCAAAGAGAATGAGAAGAAAGCCAAGAGCTTGGAAGCAGACCTCATGCAGCTACAAGAGGACCTCGCCGCCGCTGAGAGGGCTCGCAAACAAGCGGACCTCGAGAAGGAGGAACTGGCAGAGGAGCTGGCCAGTAGCCTGTCGGGAAGGAACGCACTCCAGGACGAGAAGCGCCGCCTGGAGGCCCGGATCGCCCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGGGCAACATGGAGGCCATGAGCGACCGGGTCCGCAAAGCCACACAGCAGGCCGAGCAGCTCAGCAACGAGCTGGCCACAGAGCGCAGCACGGCCCAGAAGAATGAGAGTGCCCGGCAGCAGCTCGAGCGGCAGAACAAGGAGCTCCGGAGCAAGCTCCACGAGATGGAGGGGGCCGTCAAGTCCAAGTTCAAGTCCACCATCGCGGCGCTGGAGGCCAAGATTGCACAGCTGGAGGAGCAGGTCGAGCAGGAGGCCAGAGAGAAACAGGCGGCCACCAAGTCGCTGAAGCAGAAAGACAAGAAGCTGAAGGAAATCTTGCTGCAGGTGGAGGACGAGCGCAAGATGGCCGAGCAGTACAAGGAGCAGGCAGAGAAAGGCAATGCCAGGGTCAAGCAGCTCAAGAGGCAGCTGGAGGAGGCAGAGGAGGAGTCCCAGCGCATCAACGCCAACCGCAGGAAGCTGCAGCGGGAGCTGGATGAGGCCACGGAGAGCAACGAGGCCATGGGCCGCGAGGTGAACGCACTCAAGAGCAAGCTCAGAGGGCCCCCCCCACAGGAAACTTCGCAGTGATGCACCAGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCAACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTCACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGGTGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAGCCAGGAAGA