Transcript asmbl_24845

Sequence
Transcript Sequence for observation asmbl_24845 of TGE0004408:
TTGGAGGCTTCCCCCACATTGTTTTAAAAAGTGTTTCTCCGTGACTGACCGCTGGGGCTTTCTGACCGCCTGAGGTCTTGGGCTATTTGGTCACCTTCCTTCTCGGTCCCCCAGAGGGCAAAAGGACCAGAGTGACCTCCTGCTGATCGATCTCCACACCCGAGGGTTTCTTGGACTCAGGTCGGAGCTGTGTGGACCCGCCCCCACTCCTGTGTCACCATGTCCGTGTCCACCCAGCAGCTGGCCGAGGAGATGCAGATCTTCGGCCTAGAGTACGAGGAGCCTCTGATTGAGAAATTGGCGGAGCTGTGCGTTCTGCATGGAGAGAATGAGGCGGGAATGGTAGGCGAGCTCATAGCCTTCTGCACCAGCACGCAGAAAGATCGCCTCACCGCAGAGACCCTGAACTCTTTTGAGCATGAGGTTCTGAGCAAAAGATTGGCCAGATCCCGGCACAGTGCCTCCAAGGACAGTGGGCACGCGGGAGCTAGAGACATCATTTCCATACAAGAGCTAATCGAAGTGGAGGAGGAAGAGGAGACCCTTCTGAATGCCTATTCCACACCCTCCAAGGGTTCTCAGAAGCGAGCTGTCACCACCCCAGAAACCCCCCTAACCAAAAGGAGAGTGTCTGCTCGCAGCCCCCACCAGCTCCTCTCACCATCGAGTTTCTCTCCAAGTGCTACTCCCTCTCAGAAATACAACTCGAGGAATAACCGAGGAGAAGTGGTTACCTCCTTCGGCTCGGCCCAGGGAGTGTCTTGGTCCGGGAGAGGAGGAGCCGGCATCATCAGCCTAAAGGTCTTGGGGTGTCCAGAGTCACTAACCGGGAGCTACAAATCAATGTTTCAGAAGCTGCCAGACATTCGAGAAGTTCTGACCTGTAAGGTAGAAGAACTTGGCAGTGAACTCAAGGAACATTACCAGATCGAGGCTTTTGCTCCTGTTCTAGTTCCAGCACAAGAGCCCGTCACTCTGCTGGGCCAGATTGGCTGTGATAGCAACGGGAAGCTGAACAACAAGTCGGTGATTCTAGAGGGGGACCGGGAGCATTCTTCCGGCGCTCAAGTTCCAGTGGATTTATCTGAGCTCAGAGAATACTCTCTGTTTCCTGGACAGGTTGTAATTATGGAAGGAATGAACACGACTGGTAGAAAACTCGTTGCCACTAAACTCTATGAGGGTGTGCCACTTCCATTTTATCAGCCCACCGAAGAGGAGGGAGACTTTGAGCAGAACATGGTCCTGGTGGCCTGTGGACCATACACCACGTCTGACAGCATCACATATGACCCCCTGCTCGACCTGATCACCATCATCAACCACGACCAGCCAGACATCTGCATCCTGTTTGGCCCTTTCCTGGATGCTAAGCATGAACAGGTTGAGAACTGTCTGCTGACGAGTTCGTTCGAAGATGTTTTCAAGCAGTGTCTACGAACAATTGTCGAAGGGACTCGAAGGTCAGAGTTCAGAATGCTGGGCAGAACCTTAAGCTGCCCAGGTTTCTCCAGGGCCTCCCGTTAGAAAAACAAGCTACTCGAAAGTAGTGGTAGCTCCTATCCTTTCGTCCTTTTGAAGTAGAGATCAGATAGAGCTCTTGAACTTCAAGTGCCCAGACGCGGAGTTAAGAGGCATCTTGGTAAAACAAAGATAAACACACACTAGCCGCTCTCCTTCCCCTCTCCCTCCTTCCTTCCTTGTCTCACTCCTTCCGTATAGACCCACATTCCACAGGAATCTTCCCAGGATGCTTCTGAGAAGTGATTTTGTTGATGACTTACACAGCAGAATCCCAAGAGGCCCTAGACAGCTCGTTGTGGGAGTGATTGTTTTGGGGCGAGCCCAAGTCCTTCCCCTGAGTCACTGCTTCCCCACGTTTTGTGAGGCATCGCCAGTCGCCAAAGCGAGCTGTGGTAGAAACTCAGGGAGGGTGGGGATCTCGAATCTCTGCCACAGACCAAGGAGAAGGAACTGCGAAAGGTCACGGTGGTGATGAAAGATGTGTAGTTCTAATTTAAGAGAAAAGGCGCCATTCCAGGGAGAGTCGAAAACTACAAGCAGAAGGTTATTCAGGAAGTTGACATCCTCACTTCCTGACCCTTTTCCTCCAAGGTTTCCAAGAAATTAATATAGGTGATGGGTGTTCTCTGGGGATTTGCTTTCCTGTAGTAGAGCTCATAAAAAATATTCCTGAGGCTAAGCTTTTAAAAGCAAGTCTGGAACAAAGGTGGTTTTTTAAAACAAAATGTATGATCTTCCACTGCTTGGCTGTGAGAACTGATCCCAGAGTCAGGGGACTTGAATTGTGCCGGTGACAGCCTGCAGCTGGATCCACCCCTCCCTCCCTCCTTTGAGTGAAGATGACACAGGTACCTTCCCTCTCACCTCCCAGGTTTCACCCTGAACCAAGCACATCAGCCCCGGAGAGCTCAGGAGGTACACCCCGAAAAAGCAGGAGCAGGGCTGCTGTCCCTGTGCTGTCAGCCCTCAGATCTCCTCGGGGACAGGCGGGGGCTGTGTGGCAGTGCCCAGCACCGGCGGGCTGCTGTCAGTGTGAGATCGGGTTCTGGTTTGGTTCC