Transcript asmbl_74379

Sequence
Transcript Sequence for observation asmbl_74379 of TGE0000626:
CTTTTCCGCTCCACGGTGACCTCCGTGCGGCCGGGTGCGGGCGGAGTCTTCCTCGATCCCGTGGTGCTCCGCGGCGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCCTAGTTGGCAAGCGAGCAATTTCCACCTCTGTGTGTGTACGAGCTCATGAAAGTGTTGTGAAGAGCGAAGACTTTTCGCTCCCAGCTTATATGGATCGGCGTGACCACCCCTTGCCGGAGGTGGCCCATGTCAAGCACCTGTCTGCCAGCCAGAAGGCATTGAAGGAGAAGGAGAAGGCCTCCTGGAGCAGCCTCTCCATGGATGAGAAAGTCGAGTTGTATCGCATTAAGTTCAAGGAGAGCTTTGCTGAGATGAACAGGGGCTCGAACGAGTGGAAGACGGTTGTGGGCGGTGCCATGTTCTTCATCGGTTTCACCGCGCTCGTTATCATGTGGCAGAAGCACTATGTGTACGGCCCCCTCCCGCAAAGCTTTGACAAAGAGTGGGTGGCCAAGCAGACCAAGAGGATGCTGGACATGAAGGTGAACCCCATCCAGGGCTTAGCCTCCAAGTGGGACTACGAAAAGAACGAGTGGAAGAAGTGAGAGATGCTGGCCTGCGCCTGCACCTGCGCCTGGCTCTGTCACCGCCATGCAACTCCATGCCTATTTACTGGAAACCTGTTATGCCAAACAGTTGTACCACTGCTAATAAATGACCAGTTTACCTGAAA