Transcript asmbl_25936

Sequence
Transcript Sequence for observation asmbl_25936 of TGE0000916:
AGCAGGCCGATTGGCAGGGCGGGGTTGCCTTCAATCCTGGCCACTGCTCTTAATCGTCCCTCTCCTGCTTCAGGGTGGCATTGTGTGTCCCAGAGTGCCGGAGCGAGTCCCAGAAGAGAGGCGAGGCTAAGCCCAGAGCGCTGGGTTGCTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCTGAGCACTGAGCAGCGCTCAGAATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCAAAAGGGGGGACATCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAGAGCTTAATGGAAAAGACGGCTTCATTCCCAAGAACTACATAGAAATGAAACCACATCCGTGGTTTTTTGGCAAAATCCCCAGAGCCAAGGCAGAAGAAATGCTTAGCAAACAGCGGCACGATGGGGCCTTTCTTATCCGAGAGAGTGAGAGCGCTCCTGGGGACTTCTCCCTCTCTGTCAAGTTTGGAAACGATGTGCAGCACTTCAAGGTGCTCCGAGATGGAGCCGGGAAGTACTTCCTCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTGGATTATCACAGATCTACATCTGTCTCCAGAAACCAGCAGATATTCCTGCGGGACATAGAACAGGTGCCACAGCAGCCGACATACGTCCAGGCCCTCTTTGACTTTGATCCCCAGGAGGATGGAGAGCTGGGCTTCCGCCGGGGAGATTTTATCCATGTCATGGATAACTCAGACCCCAACTGGTGGAAAGGAGCTTGCCACGGGCAGACCGGCATGTTTCCCCGCAATTATGTCACCCCCGTGAACCGGAACGTCTAAGAGTCAAGAAGCAATTATTTAAAGAAAGTGAAAAATGTAAAACACATACAAAAGAATTAAACCCACAAGCTGCCTCTGACAGCAGCCTGTGAGGGAGTGCAGAACACCTGGCCGGGTCACCCTGTGACCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATGCCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCTTTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGTTTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAGTGGGCTGGTATTCTCTCTATGCAAAATGTCTGTTTTAGTTGGAATGACTGAAAGAAGAACAGCTGTTCCTGTGTTCTTCGTATATACACACAAAAAGGAGCGGGCAGGGCCGCTCGATGCCTTTGCTGTTTAGCTTCCTCCAGAGGAGGGGACTTGTAGGAATCTGCCTTCCAGCCCAGACCCCCAGTGTATTTTGTCCAAGTTCACAGTAGAGTAGGGTAGAAGGAAAGCATGTCTCTGCTTCCATGGCTTCCTGAGAAAGCCCACCTGGGCTGGGCGCGGTGGCTCACGCCTGTAATCCCAGC