Transcript asmbl_64709

Sequence
Transcript Sequence for observation asmbl_64709 of TGE0056208:
TTCTCAGAGCCGGTGATTGGTCCCCAGCCGAGGGCCTCAGCCAATTAGCTTGCTGGGTGGGCCTGGAGTCCCGCCCCGCCCAGGCGCCCGCGGAGATCCAGGTTCGAGGCTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCAGCTCCTGCAGGAAGGCGACGACGAAAGCTCAGCCGTGGTGAAGCTGGCGAATCCCCTGCACTTCTACGAAGCCCGATTCAGCAACCTCTACGTGGGCACCAACGGCATCATCTCCACTCAGGACTTCCCCAGGGAAACGCAGTATGTGGACTATGATTTCCCCACCGACTTCCCGGCCATCGCCCCTTTTCTGGCGGACATCGACACGAGCCACGGCAGAGGCCGAGTCCTGTACCGAGAGGACACCTCCCCCGCAGTGCTGGGCCTGGCCGCCCGCTATGTGCGCGCTGGCTTCCCGCGCTCTGCGCGCTTTACCCCCACCCACGCCTTCCTGGCCACCTGGGAGCAGGTAGGCGCTTACGAGGAGGTCAAGCGCGGGGCGCTGCCCTCGGGAGAGCTGAACACTTTCCAGGCAGTTTTGGCATCTGATGGGTCTGATAGCTACGCCCTCTTTCTTTATCCTGCCAACGGCCTGCAGTTCCTTGGAACCCGCCCCAAAGAGTCTTACAATGTCCAGCTTCAGCTTCCAGCTCGGGTGGGCTTCTGCCGAGGGGAGGCTGATGATCTGAAGTCAGAAGGACCATATTTCAGCTTGACTAGCACTGAACAGTCTGTGAAAAATCTCTATCAACTAAGCAACCTGGGGATCCCTGGAGTGTGGGCTTTCCATATCGGCAGCACTTCCCCGTTGGACAATGTCAGGCCAGCTGCAGTTGGAGACCTTTCCGCTGCCCACTCTTCTGTTCCCCTGGGACGTTCCTTCAGCCATGCTACAGCCCTGGAAAGTGACTATAATGAGGACAATTTGGATTACTATGATGTGAATGAGGAGGAAGCTGAATACCTTCCGGGTGAACCAGAGGAGGCATTGAATGGCCACAGCAGCATTGATGTTTCCTTCCAATCCAAAGTGGATACAAAGCCTTTAGAGGAATCTTCCACCTTGGATCCTCACACCAAAGAAGGAACATCTCTGGGAGAGGTAGGGGGCCCAGATTTAAAAGGCCAAGTTGAGCCCTGGGATGAGAGAGAGACCAGAAGCCCAGCTCCACCAGAGGTAGACAGAGATTCACTGGCTCCTTCCTGGGAAACCCCACCACCGTACCCCGAAAACGGAAGCATCCAGCCCTACCCAGATGGAGGGCCAGTGCCTTCGGAAATGGATGTTCCCCCAGCTCATCCTGAAGAAGAAATTGTTCTTCGAAGTTACCCTGCTTCAGGTCACACTACACCCTTAAGTCGAGGGACGTATGAGGTGGGACTGGAAGACAACATAGGTTCCAACACCGAGGTCTTCACGTATAATGCTGCCAACAAGGAAACCTGTGAACACAACCACAGACAATGCTCCCGGCATGCCTTCTGCACGGACTATGCCACTGGCTTCTGCTGCCACTGCCAATCCAAGTTTTATGGAAATGGGAAGCACTGTCTGCCTGAAGGGGCACCTCACCGAGTGAATGGGAAAGTGAGTGGCCACCTCCACGTGGGCCATACACCCGTGCACTTCACTGATGTGGACCTGCATGCGTATATCGTGGGCAATGATGGCAGAGCCTACACGGCCATCAGCCACATCCCACAGCCAGCAGCCCAGGCCCTCCTCCCCCTCACACCAATTGGAGGCCTGTTTGGCTGGCTCTTTGCTTTAGAAAAACCTGGCTCTGAGAACGGCTTCAGCCTCGCAGGTGCTGCCTTTACCCATGACATGGAAGTTACATTCTACCCGGGAGAGGAGACGGTTCGTATCACTCAAACTGCTGAGGGACTTGACCCAGAGAACTACCTGAGCATTAAGACCAACATTCAAGGCCAGGTGCCTTACGTCTCAGCAAATTTCACAGCCCACATCTCTCCCTACAAGGAGCTGTACCACTACTCCGACTCCACTGTGACCTCTACAAGTTCCAGAGACTACTCTCTGACTTTTGGTGCAATCAACCAAACATGGTCCTACCGCATCCACCAGAACATCACTTACCAGGTGTGCAGGCACGCCCCCAGACACCCGTCCTTCCCCACCACCCAGCAGCTGAACGTGGACCGGGTCTTTGCCTTGTATAATGACGAAGAAAGAGTGCTTAGATTTGCTGTGACCAATCAAATTGGCCCGGTCAAAGAGGATTCAGACCCCACTCCGGGGAATCCTTGCTATGATGGGAGCCACATGTGTGACACAACAGCACGGTGCCATCCAGGGACAGGTGTAGATTACACCTGTGAGTGCGCATCTGGGTACCAGGGAGATGGACGGAACTGTGTGGATGAAAATGAATGTGCAACTGGCTTTCATCGCTGTGGCCCCAACTCTGTATGTATCAACTTGCCTGGAAGCTACAGGTGTGAGTGCCGGAGTGGTTATGAGTTTGCAGATGACCGGCATACTTGCATCTTGATCACCCCACCTGCCAACCCCTGTGAGGATGGCAGTCATACCTGTGCTCCTGCTGGGCAGGCCCGGTGTGTTCACCATGGAGGCAGCACGTTCAGCTGTGCCTGCCTGCCTGGTTATGCCGGCGATGGGCACCAGTGCACTGATGTAGATGAATGCTCAGAAAACAGATGTCACCCTGCAGCTACCTGCTACAATACTCCTGGTTCCTTCTCCTGCCGTTGTCAACCCGGATATTATGGGGATGGATTTCAGTGCATACCTGACTCCACCTCAAGCCTGACACCCTGTGAACAACAGCAGCGCCATGCCCAGGCCCAGTATGCCTACCCTGGGGCCCGGTTCCACATCCCCCAATGCGACGAGCAGGGCAACTTCCTGCCCCTACAGTGTCATGGCAGCACTGGTTTCTGCTGGTGCGTGGACCCTGATGGTCATGAAGTTCCTGGTACCCAGACTCCACCTGGCTCCACCCCGCCTCACTGTGGACCATCACCAGAGCCCACCCAGAGGCCCCCGACCATCTGTGAGCGCTGGAGGGAAAACCTGCTGGAGCACTACGGTGGCACCCCCCGGGATGACCAGTACGTGCCCCAGTGCGATGACCTGGGCCACTTCATCCCCCTGCAGTGCCACGGAAAGAGCGACTTCTGCTGGTGTGTGGACAAAGATGGCAGAGAGGTGCAGGGCACCCGCTCCCAGCCAGGCACCACCCCTGCGTGTATACCCACCGTCGCTCCACCCATGGTCCGGCCCACGCCCCGGCCAGATGTGACCCCTCCATCTGTGGGCACCTTCCTGCTCTATACTCAGGGCCAGCAGATTGGCTACTTACCCCTCAATGGCACCAGGCTTCAGAAGGATGCAGCTAAGACCCTGCTGTCTCTGCATGGCTCCATAATCGTGGGAATTGATTACGACTGCCGGGAGAGGATGGTGTACTGGACAGATGTTGCTGGACGGACAATCAGCCGTGCTGGTCTGGAACTGGGAGCAGAGCCTGAGACGATCGTGAATTCAGGTCTGATAAGCCCTGAAGGACTTGCCATAGACCACATCCGCAGAACAATGTACTGGACGGACAGTGTCCTGGATAAGATAGAGAGCGCCCTGCTGGATGGCTCTGAGCGCAAGGTCCTCTTCTACACAGATCTGGTGAATCCCCGTGCCATCGCTGTGGATCCAATCCGAGGCAACTTGTACTGGACAGACTGGAATAGAGAAGCTCCTAAAATTGAAACGTCATCTTTAGATGGAGAAAACAGAAGAATTCTGATCAATACAGACATTGGATTGCCCAATGGCTTAACCTTTGACCCTTTCTCTAAACTGCTCTGCTGGGCAGATGCAGGAACCAAAAAACTGGAGTGTACACTACCTGATGGAACTGGACGGCGTGTCATTCAAAACAACCTCAAGTACCCCTTCAGCATCGTAAGCTATGCAGATCACTTCTACCACACAGACTGGAGGAGGGATGGTGTTGTATCAGTAAATAAACATAGTGGCCAGTTTACTGATGAGTATCTCCCAGAACAACGATCTCACCTCTACGGGATAACTGCAGTCTACCCCTACTGCCCAACAGGAAGAAAGTAAGTACAGTAATGTAAAGGAAGACTTGGAGTTTACAATCAGAACCTGGACCCTAAAGAACAGTGACTGCAAAGGCAAAGAAAGTAAAAAAGGAATTGGCCATTAGACGTTCCTGAGCATCCAAGATGAACATTTTGTAGTGCAAAAAGACTTTTGTGAAAAGCTGATACCTCAATCTTTACTACTGTATTTTTAAAAATGAAGGTTGTTATTGCAAGTTTAAAAAGGTAACAGAATTTTAACTGTTGCTTATTAAAGCAACTTCTTGTAAACATTTATCATTAATATTTAAAAGATCAAATTCATTCAACTAAGAATTAGAGTTTAAGACTCTAAACCTGATTTTTGCCATGGATTCCTTCTGGCCAAGAAATTAAAGCACATGTGATCAATATAACAATATAATCCTAAACCTTGACAGTTGGAGAAGCCAATGCAGAACTGATGGGAAAGGACCAATTATTTATAGTTTCCCAACAAAAGTTCTAAGATTTTTTACCTCTGCATCAGTGCATTTCTATTTATATCAAAAGGTGCTAAAATGATTCAATTTGCATTTTCTGATCCTGTAGTGCCTCTATAGAAGTACCCACAGAAAGTAAAGTATCACATTTATAAATACCAAAGATGTAACAATTTTAAAATTTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTTCCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGCATATATGCCTTAACCACAAAGGAGAAAGGTGATTTATGCAAACATACAGTACATAATAAAAATTCTACTTTCCTAAACTTTATTAAAGAAAAAAGCAATAAGCAATGGTGGTAAATCTCTAGAACATACCCAATTTTCTGGGCTTCCTCCCCCGAGAATGTGACATTTTGATTTCCAAACATGCCAGAAGTGTATGGTTCCCAACTGTACTAAGTAGGTGAGAAGCTGAAGTCCTCAAGTGTTCATCTTCCAACTTTTCCCAGTCTGTGGTCTGTCTTTGGATCAGCAATAATTGCCTGAACAGCTACTATGGCTTCGTTGATTTTTGTCTGTAGCTCTCTGAGCTCCTCTATGTGCAGCAATCGCAGAATTTGAGCAGCTTCATTAAGAACTGCATCTGTTTTATGAGAAAAGAACACTGCTTCAATACATAATTTTTACATTTAAGGCCATTTATTTCCTCCCAAGTATTCAGTCTGTAAAAAAAATAGTTTGAATTTAAACAAAATCACTTACCTCCTGTGTCAAAACCAAGAATATGTTTGTCTAAAGCAACAGGTAAGCCCTTTAAAAAAAGAAAGACAAAATGAGAGTATTTATGGTTAAGAATAGCATCCTTTCCTCAACTGAAACTGAAAAGCACCTAGCTATTCTGGTGTCTTAACTCTTTTAGCTGCATGGGCAAGGGAACTAGGAATTTTGTTTATATTTGCTTTGTGATGATTGTGATTAGCGAGTTTTCCCTATTTCAACCGGTTAGGGGGAAAAGTTAACCTTTAAATGTACCAGGAAGCTCTATAGCTCATCCAATCCTTTAGCCCAGGCATACAAAACAATATATCCTTATTGCAGCAGTGCCTTGTCATTACTGCTATGGAAGGCAAGTTGAGCCAGGCTGTTACTGTCTTATTTTGGCGACAGTAAGCAACAGTATAAACGGCAAAAATAGTACCTTATATTCCATTTCTGAGCACATTAATTTGTCTTTACAAATTGTACGAACCTTTCAGCCAGCATGGTGTTTGCCAAGATTATGTATAATTATGTATAATTTAACTTTCAAGACTTGACTTGGAAGTTACTTTGAAACAAACAGTCTAGGAAAATGAAAAACTAAACCACTCAGCACCTATGGACATACTAAAGATGGTGACTATGGTGATGCCAAACTTCACAGAAACAAATTCTAAAATGAGGACAGTCTGTACTTCCTGCTGATTATATAAAATCACTGCCAAGAAAAACACACTACCCGTACTTTCAATCTTTCAATGTTACAACCTGTTACTATTCAAATGCTTTAGTCACTGCTCAATTCTTGCCTTATCTAGTAATGTAAATCTACGTAGGCTCTGTCTGCTTTAAAACAGCTAACACATGTAAGTCTGAAGAAACCAATGGGTACGAAAGCACAAGTGAGCAAAATTAAAGAGCAGAATTGTACTGAGTGGCTTTATATGTTCATCTAGTACCAGAGGCTCCACTTTTTTTTCCTTTGCCAACAGGCCACCAAGCTACCCCTGAAAACTACCATATGCCTCAAATAGTAGTTATAAATGCTTATAAGTACACTAGACTGTAAGAACTCCACTAAATTGTTATAGGCTGGTATCTTTTGAGATGACACCAAAATTAAAATTGGGAGCATTAAAAATAAAACTAAATTTTACTTTACAAACAAGAGCAAAGAGATTTGGCTAAGCCTTTACTTACACTGCCTTCCAAAGCATAGTTTTGCTGAAGGAATGAATGAATGAATGATTGACTTTATTACACCAGAACAATTTACTGTCTGTTCTATAGGGAGGGTGAAATAAGCTGATCTTTAACCCAACTTCCAGTGGCTCGATTCATATACAACGAGCCAGTAAGAACCTTTAAAAGAAAACAGTGTCTTTCAGAGATACTGCCCTGGCATTAGTAACCTTTTAACACTGCTTGGCCTGCCTAAAGGGGCTGGAGGACAAAAGGCATTGGGAGATGGGGGAAGGGCGCAGGGAGGACAAACAACATAGTTGTGCCCAAGGCATTCACTACAACATCATTGCTGCAGGAGGCAGGTGTTATCAGACACTGCTGCTGCTGACCTGAGGACAGTCTCTCCACCGCTGCACAGCCAGTGAAACTTTAGGCATCTTTGGATTTCTGATATAATCTAAAAATGTTCCATATTTTCTCTTTAAGGGGAAGGTAGTCATGGGATATAGCTTTTCTCAGCCTACAAGGTAGGACTGAAAGATACCATTTCAGTCACCTGTACCTTGAACCTTACACTCCAACAGAACCCCCTGTCCCTTCACCTGGGCAGACTGACAAGCTCATGCAGACATCCACGCATGGACCCTTCTCCCCACCTACCGTAAGAGCACAGGCTCTCAAGTCAGACTGCCTGAGCTCAGTCACTTACCAACTAGGTGACCTTAGCCAAATTACTTTCTCATGTTTTATGCCAGGAAATTGAATAAAACAAGAATTTACTCTGAAGAAATAAGAGCAAGGATAGAATTTAGATAGAAAAAGAAAACTAATTTGTAGTGAGGTGTGTTCCTTCTTCTCCAGCATGAGTCAAAATAATCCAGTAAGTTTCATATGGGTAACTCATTTTAAATAAACTTCAACGGGCCACAAGCATGATTTGTGGACTGTGCATGAGCTATTTGTGGCTTTTTTAAGGTACAAAGTGAGAGGAACATGAAGTTTTTCACTCAAAAATGACCCCCTAGCCACTGAATACATTCAATTTGCTTTAGGAAGCACTGAAGTAAGCTATCCTTTCTCTAAGTTGTAGAACGTAGAATGGATATCTTAAACAGATACATGCAAAGTTTAAAATCACGGCCATACCAGAAGAAATGTTCATTAACAACTTATTTAGGATTTATAGAAACGTACCTCTTTTGTTTGATTTGCCTTAGCAACTGCATCCTGTGTCAGGCGCTCCTGAACCAAAATCCGAATTGCCTAAGAAACCCAAAAATATTTTTACTTTTTATAGGCTGTGTACCTGTCATCCTTTCTTCTATGAGCCCAGAGAATAAGGATGCTCATTTTGATGAAGTCAGAATTACCTAAGTTCATTAATAAACTCCCCATTAAATTAAAAATAAAAAAAACCCACTAATATAACGTAACCTTTCACACTTCTAGTATTTTAATAATGTTGAATGGTGCTTGCAACAATTAAAACCATTTTTTGAATAGGTAATGCACGTGACTGGTAAAAAACAACTTTAAATACAGCAAGACACATGGTAAAAAGTAGGTCTCCTTCCTACCTGAGCCTTGCGATCCCCTACAGATTCCTTACCCTCACTAAAACTGCGAAATGACGAGCATGCTTAGCACGAATACACATTTTTGACACAAAGGGTAGCAGATCATACATACTGTCTTACACTTTGCTTTTATCACTTCACTCTAGTAAAATATTTTCAAACCTTTCAAAGGACACCGTTGGTGGTTTTAATCACCAAGGCATTTCATTATGGTAGGCATGCATGCAAGTATCCATACACACTTAAAAATCAAATTTTAAAAAAATGGAATTTTAATTAGGAAGATGACAATTACAACTCAAAAATAAGTGTGAAAACTTAAACTATAATTTTTAAATAAAAAACCAAATGCTATCTTTGAAAAACCGAATTCAAACAATGTTTAACAGTTATTGCAGATGTTATTAAATAGTCTGGTTGCCAAACAGTTAATATACTGATGCTTGTACTTGGCAAACGTACTAAGATGTTTTCCATATTATGTTATTGTTTGAATGCCTCTTAAAATAACTCAAAAGGGACAAATGTGCAGCAGGACTAGAATTTTATAGCATTTTGTTGTAGTTGATTTATACTTTATCCCCTTGGGTTTTGAAGTCTAACAAAAGCATCCCAAATACGCTATGCATTGTCTGACTCTCCTCTCACTTACTTTATGATTAAAGCTGACATGATCACTATAGAACAGTTCCAAGGCAATTTACATAATTGTCGGAATAAAGAACAAGCCTTTGAAATAGCTAAATTTCACTAAAAACATTTTTGTCTTTTGGCATGCAATCTGGATTGAGAAAATCCAAGTTAACATTCAGATTCAGTATAGAAAATTTTAATAACTTAGGAATACAACAGTCTTGTTAAAACTGACATTTAATAATAAAAATCTAAAAAGCATGGTAAGTTATGGCTTAATCTCTTCTGGGTAGAGTGATATTTATCACAAAGTAGTTTACATGCACAAGGTCTAGTTAAAAGCTTTTAATCTCTTATAAAATTTCCAAGTCTGGTATCTTAAGTACCACTCCCCTGATCCACACCACTGTACTTTCACGATTACTAGGAATAAATCTTCTGAAGTTTATGATTTCTCTCAGAAACAAGAGACCTCTTTCAGATTACTGGGATTCCTGAAGTATAGTTATGAACTGAGTGGCCTATCTAGCATCGGGGACAGAAAGATTCATTTCTCAAAGAGATTTTGGGGTTATATATTTTTGACCAAATTCACCATTACTCATTTGGCATTTTCGACCATCTTAACAAATGCAGACTATGAATCATTAAAAAGACTAACTAAACAGAAGTAGGGTAATGTGGGAAAAACAATGGACCACAGGGTTATAGTGCTTAAAATCCTGGCTCTGTCATTTTCTGTGTCATCTTAGACATTATCCTCATTGAGTCTCAGTTTCTTCATATGATATATATTTTTAAAAAGATATTAGCAGCTGTCTCTAGGATTGTTGGCAGGATTGAATGAGAACATCTTTGCAAAGGATTTAGCATAGTGCAGGCAGAAAACAGAATCCAAATCAGATAAAACCATGAAATCTACTTTATGTTTCATATTCTTCTGTGTATTTTAGTCATTCAACCATAATTTTAATATCAATAGTTAATATTTAGAAAATAAAGACATTTTTCTATGTGCACAGTTTCTGTCAAGAATCAAGAACATGAAGCTGACCTTAAGCATTACCAGGTAATCATCATGACGCTGAATCTGAAGCAGGTTAGCCAAAGCCATCACACCAGCCTTAAAATCAGGATTATTTACTATAAAAGATTAAAAACAAACAAAAACTTACAACCCTGCAAACGTATAATTACAAACATATTTGTGAACATACAAAAACATTTTTAACTTTTCGGTAGCAACAAATCTCTTAGTTTTTAAAACTGCTACTCACAAGAGAAAAAAGAAAGCCCTGTAGACTATCAACAATTAAATAAATTGGTAAGATAAAATGGTTTTCCTATTACTGTATGAGACGGTCCCCAACTTAGGATGGTTAGACTTGTAATTTTTTGACCTTACAATGAGTTCAGTGGGATGTAACCCTAGTGCAAGATGAGGAAAATCTGAACTTACAGTGGTTCCAACTACAATTTTTCAGCTTTACAATGGGTCTTCCGGGGTATTAAATGCATTTTTGACTTATGATATTTTCGACTTTGGGACATGATCTCATCCTAAGTCAAGGAGTATCTGTATTTCATCAGCCAAACTGAATAATCCAATAAATGACTAATTTAACTCACATTATATTTGTCCTGTAACTTTTTCTGCAAGGCTAAATTATACAGCACTTTTAATTAACATTTCTTCCCAAGGCCATTAATTTTAGTACATAGATCCCCTCCATGGATAGTTTTCCCAAAACCTTCTCTCTAAGCAGCAGCTCTGGAGTGTCCAAGAGGCTCACTCATTCAAAAGGGTTAACTCCTAAATTATAGGTCACAATGAATTAGCCAGTGAACAAATATTTTACACATCATAATTTAGGTAATTAGATTCTTCATATTTTTAAAAAGGGAAATTACTAAAAGATATCCAGGACTTAAAATAATGGAAAATTTTACCACTTGTCTGATAGAGTCATTGGATTAAAAGAAATTTACACATTCAAAAAGGCAAACAATGACCCCCATGATTAAATACAAATCAAAACTCCAAATTACTAGAAGCAAATCAAATCAACATTCAGATATTCAAATGCAAGGGGAAGGAGAAAGCACATCATAAAAACATTATAGAGAATAAAATGTTAACATAAATGCTGTCTGCATGGATCCTTCTAAATTTACTAAAACCAAGTAAACCTGGACTTCATTCTTCAAAGAAAAAAACATTTAAAAAACCAAAAATGTTGATGTTCAATGTTATGCATTTATATACTCACCATCCAAATTGATCAATGGTTCTGCATTTTTAGTTGCATTGTCAGCAGTTTTTGAATTATCAGGTACTAAATCCTTGTATTTTTCAGCTATAAAAACAGGCAAAAATATAATTTGTACAACTGCAACTCAAGGTAAAATGACTACTGCTATTTACCAAATTTAACTGAGCCAAAATGATTACAGGTTGAGTTTCCCTTACTGGAAATGCCAATAATTTCCAATTTTAAATTTTTTCAGACTTCGGATTATCTGCATATATAAAATGGGATATTTTGGGGATGGGACTGAAGTCTAAACACAAAATTCATTTTTATGTTCAATGTACAACTTATACACATAGCCTGAAGGTAA