Transcript asmbl_52704

Sequence
Transcript Sequence for observation asmbl_52704 of TGE0056195:
TCCCGGAGAGCTGAGCAGTCAAGATGTGTGACTTCACCGAAGACCAGACCGCAGGTAGGTTATCTCTGATCCCTACCGAGGTCACCCTTAGGGAGAGGGACACCCTCCCCCCAGCACCTATCCTCTAATCTTAATCTGTCATCTCTTTAGCACCCCCATGAGATTACCCCCTGGATTATTTTCTCTTCTTCTGGATCCTCCATTTTCTTTTCTCACTTTCTTCCTCCCTCCCCTTCCACTCTAGATCTGATCCCAAGCACTGGGTGAGTTTTAGGTGGTGTGGGTATGTGAAAAAACTTGGTCACTTAATGCCTGCTGTGTGTGGGGTCTCGGGAGGGTGTATAAAGCTGCCTGCTTTCCTTTGTCCTTTAATCAGCTACTTCTGCCTCTTTTCTCCTCTTGTGATAACTGTCCCCGCCCTCCCAGCTTGCAGTTGTGAAGATTGTAGAGCAGTGACCTGATATTCTGTGCAGATGGGGACAAGACAGGGGAGTTTGCTAAGGATATGACTGTAGCTATACCCTCTGGAAGTTCTCTTTATACTGGAGGGGTGCGAAGTGGCAGGTTGGGATGACCCTAGTCCCAGGCTGCTGCTCCCACTTCCTTATAAGGACAGGACTGAGACTGGGCGGTGGCGAATTCCTGCCCTGAGAAGTGTAGTAGCAGCAGTGGAGATTGGCAGGCCTGCCGCAGGCAGAGGGGTTGTGTAAATGGATGTTACCAGGCTGCCAGAAGGGGAGGAAGCCTCTATATAGAACACTTGAGTTGGGAGGAAGAGAAATAGAGCCCTCTTAAGTAGACTTTGGTGTACAGTTTGGTGCAGATATCTCGTTTCCTCAGCATGATCAAAGTTGAATGGGCAGCAGAGCTCTGAGGTAGGGTTTGGATTAACCCTCAAATCCTGTGTTGACATTCATCTGAATCCTCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGGTAAGAGGTGAACTGCGCTTTCTCAGAGAAAGCAGCCATATGGGGCAGGTCAAGTATAGTGTCTGGGGCTTTCCCTATCCCTGGACTTGGGCTCCAAAAAGAGCCAGGAGGCAAGGTGCAGGGCCCTGCCCAGCCCAGCCCAGGAGTGGGAGGTCAGGGCGGTATAACAGGAAAGGAAGGGGGTAGTATTGTAGAGGGTGGGAAGGAATGAGAAGTGAAATAATGGAATGTCTGTCCCCACTGCCTGACCCCTCACCCCATGTCTTTGTCTTGTCTTCACCATGAATGTCTCTTCCTTCCTGCAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGGTACGGCTCCTCCCAGCCTCTCCTCTAGTTGATCTCCCCAGTGTTTCTTTTTTCCCCAACCTGTGCTCTTTATCCCCTGCCCTTACCCTACTACCATCTGACTTCCTCCTGGCATGTTTCTGCATGGAGCTGACTAGGGAGGGGAGGGATTCCTCAAAGAGGAAGACAACCTGGGGGTACAGTACCTCCTTACCTCTAGAATGGGCCCTGAGGTTTTACTTATGCGGCCCTGGGTGCTGGTGTCTGGGAACTCTCACCAGCCTGTATACCAGTCTTGCTTTAGGGTGACCTTCTGGCCCTGGAGCATGGGTAGCTGGCATAGAGGGGTATGGGTTGCCTGCCCCATTCTGCTGCTATAGCTGAACAGTCCTTTCCCCTTCCCTCGCTGGGCAGCTTGGAGGTACCCTAACCCAAAACTCTGTCCTCTCCTCCCGCCAGTGGCTGACAGTAGCTGTAGGTGTAGTGGAGAACTTTTCTGCCTCTGCTGTGTTCTTGCTGCTTAGGTTTGGGTGGGGGACTAACAGCTGCTGGGAGGGGAGCTAGGGGCATGGAGAACTGGTCAGACTCAAGGTGGCTCCTCTGCAAACTGACCCCAGGGTTGGTTGCTGTGGGCATGTTCCCGCTTATGCTACCTTTGCAGTCTGGTAGTCCCCTGGCCCTTGGCGTACCCCTCCACAGCCCTGTTCCCTGGCTCATCCCACCTTTCCTTTCCACAGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGGTGCAGGGGTTGAGGAAAGCTGGGGGAGGCCCTGTACTAGCCATCTGGGCTTCATTTAAAAACTACTGGCCCCATTCATCCATCTTACACAAGCTACCTCTTGGGAGATTAGGAAAGCCATAGATCCCAGTAGGACTAAGGCTGGCCATCCCTGTTCCATTCCATATCAGGCTGTCTTCTCCTACCCTTCCAGCTCCTTAAATCTGGCCCCCGCCCTCCCAAGCTCCCAATAAGGCCTTTTGTGGGGAAGCCTGTGGAGTGTTTATTGGAGCTAAAGCCAGGCCATTATTAGCACTGCCTAAGCCTGTCCGTCACCTCAGCAGGGTGAAGGGCCAATTATAACAAAAGTAGGTAAGGGGCTTGCCTCCTCTCTAATAAGGGAAGGAGTGAAACCACTACTTCTGAAGGGACAGAGATACAAAATTCCATGTTGTGGGAATGTCCTTCCAAGTCTTAAACAGCTTTTAGGGCAGGTGAGAGCCTCTGCTCCTATACCAGCACATAGTCTCGACAGTTGTGCTGCCGTTCGTGTTTTGTGGGGAGGCGCAGTGTCTGTAGGCCGTGTGGCTTGCAGAGTGTCTTTCGGCCCAGGTAAACGCCGCTGTGAAGGACTCCAGGAAAGCTGCTCCCATCACAATCCCCCTGCCTGACAGCCACAGGAGTCCATGGATACAGCCCAGGGAAGGAAGGAGAACAGCCCCCAGTGCCCTTTCTTCTCCTATTACCTACCACAGAAATCCCCGAAATTAGGTTTTCCCCACCAAATACACATACGCTGACATCAACTAAGCAAGTGACTTTTAAAAACAAAACTGACATTCAGAGGGAAAGGAATCATTGGCTGAGCTGGGGTGGCCTAAAACAGCAACAATGAGGAAGCCGCAGGAGGGATTATTAGTACGAATGAACTCGAATAAGCTCAGCGTAGGG