Transcript asmbl_22562

Sequence
Transcript Sequence for observation asmbl_22562 of TGE0056752:
GACCAGCCTTAAAAAGTAATTTTAAAATATCACTGGTAAAATGTGGATTCAGTCATGATTGAGTGCAGTTTACCATGTGTGTGGACATTTATTTATTTTAAAATTGTCTGATCACCACCTTGAGTAAAACACAAGCAGTCACAATTAAAATATATTAGTGAGCAGGAGAAAGCACAGCATATTATAGCACTGAATGATTTATAAACCTATTCCAGGGTCATAAAATGTGTCAACGGCTTTTCTATAGTAAGGAGACTAGGTTCAGATGGTTAATCTAAGACAAATAAATGAGATAAGCCATACACTTTTACATCCTCCATGTCCTGTCTTTTCTCTGTTCAAAATAGGATGTTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGTTAGTGGAGTGACTTTCGGGGAATGAATGAGGGTAAGGCAGCCCCCACGGTTGGCAGAGCTGACCGTCTGTCTGTTCTTTTTGCAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCCCTGAACCTGAGGGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAGCATCACGATGACCTTGAATAAAAATTGCACACACTCAGTGCAGCAATATATTACCAGCAAGAATAAAAAAGAAATCCATATCTTAAAGAAACAGCTTTCAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGGAATAGGAATAAGCTCTAGTTCTTAACAACCGACACTCCTACAAGATTTAGAAAAAAGTTTACAACATAATCTAGTTTACAGAAAAATCTTGTGCTAGAATACTTTTTAAAAGGTATTTTGAATACCATTAAAACTGCTTTTTTTTTTCCAGCAAGTATCCAACCAACTTGGTTCTGCTTCAATAAATCTTTGGAAAAACTC