Transcript asmbl_20448

Sequence
Transcript Sequence for observation asmbl_20448 of TGE0056810:
GAGGGGCCAAAGCTCGGGGATGGACAAGAGAAAGGAAGGAGATGTCACTGCTGAATTTCTGCTGAATTTCCTTCTGCCTGCTGCCCGATTTCTATTTGACTGGCAATAGTCTGAGGAGGACCTATTAGAGCCTTTGCCCCGGCGTCGGTGACTCAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCGAGGTCCGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCGGCGCACTCCGACTCCGAGCAGTCTCTGTCCTTCGACCCGAGCCCCGCGCCCTTTCCGGGACCCCTGCCCCGCGGGCAGCGCTGCCAACCTGCCGGCCATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGGCCAGCTCCACTCCGCTGTCGCCCACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGATCGCTTGGCGGTCTACATCGACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGCCTTCGCATCACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTTTAAGGAGCTGAAAGCGCGGTGAGTTCGCCCAGGTGGCTGCGTGCCTGGCGGGGAGTGGAGAGGGCGGCGGGCCGGCGCCCCTGGCCGGCCGCAGGAAGGGAGTGAGAGGGCCTGGAGGCCGATAACTTTGCCATAGTCTCCTCCCTCCCCGGAACTGCCCCCAGCGGGTGACTGGCAGTGTCAAGGGGAATTGTCAAGACAGGACAGAGAGGGAAGTGGTGGTCTCTGGGAGAGGGTCGGGGAGGATATAAGG