Transcript asmbl_204407

Sequence
Transcript Sequence for observation asmbl_204407 of TGE0059093:
CCTAGAGAAAGAATGCTGGCAAAGATCTCTACCACATGGAAACTGTTCTTAAAGCTGCTGGGCCCTGAAATTTTACTCAGCAGTTTGAAATCAAGACATAGCTTTTCTCATTCACCCTCCCACTTGGGGCTAATGCACAGACATGAACATCTATTGAGGAAAACCACAAAAAACTTCAAAACAGCTACAACGACTCTGCAGTCTACACTTCTCCTGTTACTGCTTGTGCCTCTGATAAAGCCAGCACCACCAACCCAGCAGGACTCACGCATTATCTATGATTATGGAACAGATAATTTTGAAGAATCCATATTTAGCCAAGATTATGAGGATAAATACCTGGATGGAAAAAATATTAAGGAAAAAGAAACTGTGATAATACCCAATGAGAAAAGTCTTCAATTACAAAAAGATGAGGCAATAACACCATTACCTCCCAAGAAAGAAAATGATGAAATGCCCACGTGTCTGCTGTGTGTTTGTTTAAGTGGCTCTGTATACTGTGAAGAAGTTGACATTGATGCTGTACCACCCTTACCAAAGGAATCAGCCTATCTTTACGCACGATTCAACAAAATTAAAAAGCTGACTGCCAAAGATTTTGCAGACATACCTAACTTAAGAAGACTCGATTTTACAGGAAATTTGATAGAAGATATAGAAGATGGTACTTTTTCAAAACTTTCTCTGTTAGAAGAACTTTCACTTGCTGAAAATCAACTACTAAAACTTCCAGTTCTTCCTCCCAAGCTCACTTTATTTAATGCAAAATACAACAAAATCAAGAGTAGGGGAATCAAAGCAAATGCATTCAAAAAACTGAATAACCTCACCTTCCTCTACTTGGACCATAATGCCCTGGAATCCGTGCCTCTTAATTTACCAGAAAGTCTACGTGTAATTCATCTTCAGTTCAACAACATAGCTTCAATTACAGATGACACATTCTGCAAGGCTAATGACACCAGTTACATCCGGGACCGCATTGAAGAGATACGCCTGGAGGGCAATCCAATCGTCCTGGGAAAGCATCCAAACAGTTTTATTTGCTTAAAAAGATTACCGATAGGGTCATACTTTTAACCTCTATTGGTACAACATATAAATGAAAGTACACCTACACTAATAGTCTGTCTCAACAATGAGTAAAGGAACTTAAGTATTGGTTTAATATTAACCTTGTATCTCATTTTGAAGGAATTTAATATTTTAAGCAAGGATGTTCAAAATCTTACATATAATAAGTAAAAAGTAAGACTGAATGTCTACGTTCGAAACAAAGTAATATGAAAATATTTAAACAGCATTACAAAATCCTAGTTTATACTAGACTACCATTTAAAAATCATGTTTTTATATAAATGCCCAAATTTGAGATGCATTATTCCTATTACTAATGATGTAAGTACGAGGATAAATCCAAGAAACTTTCAACTCTTTGCCTTTCCTGGCCTTTACTGGATCCCAAAAGCATTTAAGGTACATGTTCCAAAAACTTTGAAAAGCTAAATGTTTCCCATGATCGCTCATTCTTCTTTTATGATTCATACGTTATTCCTTATAAAGTAAGAACTTTGTTTTCCTCCTATCAAGGCAGCTATTTTATTAAATTTTTCACTTAGTCTGAGAAATAGCAGATAGTCTCATATTTAGGAAAACTTTCCAAATAAAATAAATGTTATTCTCTGATAAAGAGCTAATACAGAAATGTTCAAGTTATTTTACTTTCTGGTAATGTCTTCAGTAAAATATTTTCTTTATCTAAATATTAACATTCTAAGTCTACCAAAAAAAGTTTTAAACTCAAGCAGGCCAAAACCAATATGCTTATAAGAAATAATGAAAAGTTCATCCATTTCTGATAAAGTTCTCTATGGCAAAGTCTTTCAAATACGAGATAACTGCAAAATATTTTCCTTTTATACTACAGAAATGAGAATCTCATCAATAAATTAGTTCAAGCATAAGATGAAAACAGAATATTCTGTGGTGCCAGTGCACACTACCTTCCCACCCATACACATCCATGTTCACTGTAACAAACTGAATATTCACAATAAAGCTTCTGAGTAACACTTTCTGATTACTCATGATAAACTGACATGGCTAACTGCAAGAATTAAATCTTCTATCTGAGAGTAATAATTTATGATGACTCAGTGGTGCCAGAGTAAAGTTTCTAAAATAACATTCCTCTCACTTGTACCCCACTAAAAGTATTAGACTACACATTACATTGAAGTTAAACACAAAATTATCAGTGTTTTAGAAACATGAGTCCGGACTGTGTAAGTAAAAGTACAAACATTATTTCCACCATAAAGTATGTATTGAAATCAAGTTGTCTCTGTGTACAGAATACATACTTATTCCCATTTTTAAGCATTTGCTTCTGTTTTCCCTACCTAGAATGTCAGATGTTTTTCAGTTATCTCCCCATTTGTCAAAGTTGACCTCAAGATAACATTTTTCATTAAAGCATCTGAGATCTAAGAACACAATTATTATTCTAACAATGATTATTAGCTCATTCACTTATTTTGATAACTAATGATCACAGCTATTATACTACTTTCTCGTTATTTTGTGTGCATGCCTCATTTCCCTGACTTAAACCTCACTGAGAGCGCAAAATGCAGCTTTATACTTTTTACTTTCAATTGCCTAGCACAATAGTGAGTACATTTGAATTGAATATATAATAAATATTGCAAAATAAAATCCATCTAAATAGAAGGGTTCTGTTTTATTTGGAAAAATTGAATCTTTAAACTATCATAATCTTGAATGACTGTCATCTTTCTAGTTTTCAGAAAAATAATGTATTCCTATATTATTTTTATGATAAAACTTATGGAGCAAAACACCATCAAATAACTCTCAAATTAAGAAAAAATTCAAAAGTCAGTAGTTTTAGATAAGATAATGATAAGGGAGAAAGAACATTGGTAAAAGGTATGAATTCCAGAATTAAAGAAATAATTTGGGGATTTCTAGATAAGAGGATATATATGAACATGCATACCTTACACCTTCATATACACAACCTTAAATCACAAATAAAACAAAATAAACAATACAAATTATACCACCAAGATTCAGAAGATATCAGACGAAATAATTAGAGAAAGTAAAAATATGCTGTCTCCATTATATTCATAATGTTTCATTCTTGACACTAATAATTAGAGGCTTTAAATTTTTAAATGATTTACTTTTTACTAACATTGCTGAAAAAAACTAAAGACATACATAAATGGAAAGATGTCTTGTGTTTATGGATGGTAAGATTTAATGTTGTTAAGACAACAATACTATCCAATATGATATGCAGACTGAACACAGTTGCCATCAAAATCTCAATGATGCTTTCACACAAATAAAATGGAACTTCAAGAGACCCCCAAATAAAGAGAAGAATCTTGAAAATAAGAATAAAGATAGAAGACTCACATTTCCTAACTTCAACATTTACAACAAAGATACAGTAATGAAAACAGTGTGTGGCTGGGCGCAATGGCTCACACCTGTAATCCCAGC