Transcript asmbl_11128

Sequence
Transcript Sequence for observation asmbl_11128 of TGE0000089:
GGCGGGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAAATATAGACGAGTTCGTCACGGACCAAAACAAGATCGTGACATACAAATGGCTGAGCTATACACTAGGGGTTCATGTTAACCAGGCCAAACAGATGCTGTATGATTATGTTGAAAGGAAACGAAAAGAAAATTCAGGAGCCCAACTGCATGTTACCTACTTGGTGTCTGGCAGTCTCATTCAGAATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTAGCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTCAATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCAGCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCACATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAGGTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACCCAAGAAACCAACAAGGAAACGAAAACAGAGGCTAAAGAAGTAACAAATGCATCTGCAGCAGGCAACAAGGCACCAGGGAAAGGGAATATGATGAGCAACTTTTTTGGAAAAGCTGCTATGAATAAATTTAAAGTCAATTTGGACTCAGAACAAGCAGTGAAAGAAGAAAAAATAGTGGAGCAGCCTACAGTGTCTGTCACGGAACCAAAGCTGGCAACTCCTGCAGGCCTGAAAAAATCCAGCAAAAAAGCAGAGCCTGTTAAGGTGCTGCAGAAGGAAAAAAAAAGGGGGAAGCGAGTAGCATTATCTGATGATGAGACAAAGGAAACTGAAAACATGAGGAAAAAGAGGAGAAGAATCAAACTTCCTGAATCTGATAGCAGTGAAGATGAAGTCTTTCCAGACTCTCCTGGGGCTTATGAAGCTGAGTCACCATCCCCACCTCCTCCTCCGTCTCCACCTCTTGAACCAGTGCCAAAGACTGAGCCTGAACCTCCTTCTGTCAAGAGCTCAAGTGGAGAAAACAAAAGAAAACGAAAACGCGTACTAAAATCTAAAACTTACCTGGATGGGGAAGGCTGCATAGTGGTGCTGGACATGCAGTCCCACTCACTAGACATTTTGGAGCATTACGTGGAAATGCCCATC