Transcript asmbl_172276

Sequence
Transcript Sequence for observation asmbl_172276 of TGE0056404:
TATTCTTCTGGAGCCCTTGGAGGGGCTCCAAACTGAGAGGGGAGGGAAGACCGCAGGGAAAGGCGGACCTCAGTGTCTGAAAAGCCAGCTTAGAGTGGGAGGGCCTGGGAGTAGAAGGTAAAAAGGGAGTGGTGAGAATGAATGTGAGAAGGAAGCCAGGACAGCGCAGTCCCCAGTCCCGAACGGCCAGGGAGAGGAGGTGGCCTAGCGCTGGCGGGGCTCACCCCAATCCGTCTGCCTTTTGATGCCGTACTCTGCTGGTTGCGCAGCCACCTCGGGATACTGCACACGGAGAGGAGGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGCCCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGAAATGCAATGCTGGATTCTTTCACACCCTGTCGGGAGAATGTGTGCCCTGCGACTGTAATGGCAATTCCAACGAGTGTTTGGACGGCTCAGGATACTGTGTGCACTGCCAGCGGAACACAACAGGAGAGCACTGTGAAAAGTGTCTGGATGGTTATATCGGAGATTCCATCAGGGGAGCACCCCAATTCTGCCAGCCGTGCCCCTGTCCCCTGCCCCACTTGGCCAATTTTGCAGAATCCTGCTATAGGAAAAATGGAGCTGTTCGGTGCATTTGTAACGAAAATTATGCTGGACCTAACTGTGAAAGATGTGCTCCCGGTTACTATGGAAACCCCTTACTCATTGGAAGCACCTGTAAGAAATGTGACTGCAGTGGAAATTCAGATCCCAACCTGATCTTTGAAGATTGTGATGAAGTCACTGGCCAGTGTAGGAATTGCTTACGCAACACCACCGGATTCAAGTGTGAACGTTGCGCTCCTGGCTACTATGGGGACGCCAGGATAGCCAAGAACTGTGCAGTGTGCAACTGCGGGGGAGGCCCATGTGACAGTGTAACCGGAGAATGCTTGGAAGAAGGTTTTGAACCCCCTACAGGCTGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGGAAAATCAAGCCTCCAGAAAAGGACAACTTGTTCAGAAGGAAAGCATGGACACCATTAACCACGCAAGTCAGCTGGTAGAGCAAGCCCATGATATGAGGGATAAAATCCAAGAGATCAACAACAAGATGCTCTATTATGGGGAAGAGCATGAACTTAGCCCCAAGGAAATCTCTGAGAAGCTGGTGTTGGCCCAGAAGATGCTTGAAGAGATTAGAAGCCGTCAACCATTTTTCACCCAACGGGAGCTCGTGGATGAGGAGGCAGATGAGGCTTACGAACTACTGAGCCAGGCTGAGAGCTGGCAGCGGCTGCACAATGAGACCCGCACTCTGTTTCCTGTCGTCCTGGAGCAGCTGGATGACTACAATGCTAAGTTGTCAGATCTCCAGGAAGCACTTGACCAGGCCCTTAACTATGTCAGGGATGCCGAAGACATGAACAGGGCCACAGCAGCCAGGCAGCGGGACCATGAGAAACAACAGGAAAGAGTGAGGGAACAAATGGAAGTGGTGAACATGTCTCTGAGCACATCTGCGGACTCTCTGACAACACCTCGTCTAACTCTTTCAGAACTTGATGATATAATAAAGAATGCGTCAGGGATTTATGCAGAAATAGATGGAGCCAAAAGTGAACTACAAGTAAAACTATCTAACCTAAGTAACCTCAGCCATGATTTAGTCCAAGAAGCTATTGACCATGCACAGGACCTTCAACAAGAAGCTAATGAATTGAGCAGGAAGTTGCACAGTTCAGATATGAACGGGCTGGTACAGAAGGCTTTGGATGCATCAAATGTCTATGAAAATATTGTTAATTATGTTAGTGAAGCCAATGAAACAGCAGAATTTGCTTTGAACACCACTGACCGAATTTATGATGCGGTGAGTGGGATTGATACTCAAATCATTTACCATAAAGATGAAAGTGAGAACCTCCTCAATCAAGCCAGAGAACTGCAAGCAAAGGCAGAGTCTAGCAGTGATGAAGCAGTGGCTGACACTAGCAGGCGTGTGGGTGGAGCCCTAGCAAGGAAAAGTGCCCTTAAAACCAGACTCAGTGATGCCGTTAAGCAACTACAAGCAGCAGAGAGAGGGGATGCCCAGCAGCGCCTGGGGCAGTCTAGACTGATCACCGAGGAAGCCAACAGGACGACGATGGAGGTGCAGCAGGCCACTGCCCCCATGGCCAACAATCTAACCAACTGGTCACAGAATCTTCAACATTTTGACTCTTCTGCTTACAACACTGCAGTGAACTCTGCTAGGGATGCAGTAAGAAATCTGACCGAGGTTGTCCCTCAGCTCCTGGATCAGCTTCGTACGGTTGAGCAGAAGCGACCTGCAAGCAACGTTTCTGCCAGCATCCAGAGGATCCGAGAGCTCATTGCTCAGACCAGAAGTGTTGCCAGCAAGATCCAAGTCTCCATGATGTTTGATGGCCAGTCAGCTGTGGAAGTGCACTCGAGAACCAGTATGGATGACTTAAAGGCCTTCACGTCTCTGAGCCTGTACATGAAACCCCCTGTGAAGCGGCCGGAACTGACCGAGACTGCAGATCAGTTTATCCTGTACCTCGGAAGCAAAAACGCCAAAAAAGAGTATATGGGTCTTGCAATCAAAAATGATAATCTGGTATACGTCTATAATTTGGGAACTAAAGATGTGGAGATTCCCCTGGACTCCAAGCCCGTCAGTTCCTGGCCTGCTTACTTCAGCATTGTCAAGATTGAAAGGGTGGGAAAACATGGAAAGGTGTTTTTAACAGTCCCGAGTCTAAGTAGCACAGCAGAGGAAAAGTTCATTAAAAAGGGGGAATTTTCGGGAGATGACTCTCTGCTGGACCTGGACCCTGAGGACACAGTGTTTTATGTTGGTGGAGTGCCTTCCAACTTCAAGCTCCCTACCAGCTTAAACCTGCCTGGCTTTGTTGGCTGCCTGGAACTGGCCACTTTGAATAATGATGTGATCAGCTTGTACAACTTTAAGCACATCTATAATATGGACCCCTCCACATCAGTGCCATGTGCCCGAGATAAGCTGGCCTTCACTCAGAGTCGGGCTGCCAGTTACTTCTTCGATGGCTCCGGTTATGCCGTGGTGAGAGACATCACAAGGAGAGGGAAATTTGGTCAGGTGACTCGCTTTGACATAGAAGTTCGAACACCAGCTGACAACGGCCTTATTCTCCTGATGGTCAATGGAAGTATGTTTTTCAGACTGGAAATGCGCAATGGTTACCTACATGTGTTCTATGATTTTGGATTCAGCGGTGGCCCTGTGCATCTTGAAGATACGTTAAAGAAAGCTCAAATTAATGATGCAAAATACCATGAGATCTCAATCATTTACCACAATGATAAGAAAATGATCTTGGTAGTTGACAGAAGGCATGTCAAGAGCATGGATAATGAAAAGATGAAAATACCTTTTACAGATATATACATTGGAGGAGCTCCTCCAGAAATCTTACAATCCAGGGCCCTCAGAGCACACCTTCCCCTAGATATCAACTTCAGAGGATGCATGAAGGGCTTCCAGTTCCAAAAGAAGGACTTCAATTTACTGGAGCAGACAGAAACCCTGGGAGTTGGTTATGGATGCCCAGAAGACTCACTTATATCTCGCAGAGCATATTTCAATGGACAGAGCTTCATTGCTTCAATTCAGAAAATATCTTTCTTTGATGGCTTTGAAGGAGGTTTTAATTTCCGAACATTACAACCAAATGGGTTACTATTCTATTATGCTTCAGGGTCAGACGTGTTCTCCATCTCACTGGATAATGGTACTGTCATCATGGATGTAAAGGGAATCAAAGTTCAGTCAGTAGATAAGCAGTACAATGATGGGCTGTCCCACTTCGTCATTAGCTCTGTCTCACCCACAAGATATGAACTGATAGTAGATAAAAGCAGAGTTGGGAGTAAGAATCCTACCAAAGGGAAAATAGAACAGACACAAGCAAGTGAAAAGAAGTTTTACTTCGGTGGCTCACCAATCAGTGCTCAGTATGCTAATTTCACTGGCTGCATAAGTAATGCCTACTTTACCAGGGTGGATAGAGATGTGGAGGTTGAAGATTTCCAACGGTATACTGAAAAGGTCCACACTTCTCTTTATGAGTGTCCCATTGAGTCTTCACCATTGTTTCTCCTCCATAAAAAAGGAAAAAATTTATCCAAGCCTAAAGCAAGTCAGAATAAAAAGGGAGGGAAAAGTAAAGATGCACCTTCATGGGATCCTGTTGCTCTGAAACTCCCAGAGCGGAATACTCCAAGAAACTCTCATTGCCACCTTTCCAACAGCCCTAGAGCAATAGAGCACGCCTATCAATATGGAGGAACAGCCAACAGCCGCCAAGAGTTTGAACACTTAAAAGGAGATTTTGGTGCCAAATCTCAGTTTTCCATTCGTCTGAGAACTCGTTCCTCCCATGGCATGATCTTCTATGTCTCAGATCAAGAAGAGAATGACTTCATGACTCTATTTTTGGCCCATGGCCGCTTGGTTTACATGTTTAATGTTGGTCACAAAAAACTGAAGATTAGAAGCCAGGAGAAATACAATGATGGCCTGTGGCATGATGTGATATTTATTCGAGAAAGGAGCAGTGGCCGACTGGTAATTGATGGTCTCCGAGTCCTAGAAGAAAGTCTTCCTCCTACTGAAGCTACCTGGAAAATCAAGGGTCCCATTTATTTGGGAGGTGTGGCTCCTGGAAAGGCTGTGAAAAATGTTCAGATTAACTCCATCTACAGTTTTAGTGGCTGTCTCAGCAATCTCCAGCTCAATGGGGCCTCCATCACCTCTGCTTCTCAGACATTCAGTGTGACCCCTTGCTTTGAAGGCCCCATGGAAACAGGAACTTACTTTTCAACAGAAGGAGGATACGTGGTTCTAGATGAATCTTTCAATATTGGATTGAAGTTTGAAATTGCATTTGAAGTCCGTCCCAGAAGCAGTTCCGGAACCCTGGTCCACGGCCACAGTGTCAATGGGGAGTACCTAAATGTTCACATGAAAAATGGACAGGTCATAGTGAAAGTCAATAATGGCATCAGAGATTTTTCCACCTCAGTTACACCCAAGCAGAGTCTCTGTGATGGCAGATGGCACAGAATTACAGTTATTAGAGATTCTAATGTGGTTCAGTTGGATGTGGACTCTGAAGTGAACCATGTGGTTGGACCCCTGAATCCAAAACCAATTGATCACAGGGAGCCTGTGTTTGTTGGAGGTGTTCCAGAATCTCTACTGACACCACGCTTGGCCCCCAGCAAACCCTTCACAGGCTGCATACGCCACTTTGTGATTGATGGACACCCAGTGAGCTTCAGTAAAGCAGCCCTGGTCAGCGGCGCCGTAAGCATCAACTCCTGTCCAGCAGCCTGACATGACAGAGCACAGCTGCCCAAATACAAAGTTCTTTAGAGCACTGAAAGAAACACAAAGCCAGCCAGGAGGAACAGTAACTCTTCCTTCGGGTGGAAGCTTTCATCGAGTTGAACAGGACTTAAACGAATCATCAGGGACCGGATATTTCTTATTTCTCATTTGGATTCTTAACCTTGAATCCAAAGTGTCTGCAATGGACAACAATTGAAGGAGTGGCAAACTTACTTGTATTGAGAGCACACGCAATTCCTACTGGTGAAATTACTGTTTCTGTTTCTAATAAAATAGAAGGGATTCCAAATAAACACTTGCACACATTTTTGAAGTGCGGCTAGATTCTCAGATTCACCTTTCTTCCAGGGAAGATAACTTTCAATCTATATAAAAATCTCTGTCCTAAAACTACCTTTCTTTATTTTGAAGAGACTTACTAACTTACATATAATCTAAATTAGATGATAGATTTGTTTTTAGCCCTTTTGTTTGGTCTATCAGTATAAGAAGAATATTTTAGGTTTATAGCTGAAGTTATCAAGGTTTAATAAAGTAAATTTCTAACAGAATACTAGAAAAATGCAGTATAATTTAATTTTTTCTAAATAAGAAACACAGGAAATCAACTACTTTTTCCCCTTCCTTATCTCCTTAAAAGAAAAATAAAATTGTACATGAGAGGAGGCTTCTGTAGGTTATTATTACCATTATTGTGTGTTCTATGGGAATCATTGAGGATATCACAGCAAAAACAGTAGGACAAAATCATAAAATTCAATTTAAGAGTACACAAGTCCTTTTATTAAAAGTTTGCTCCTAGCCTGGGCAACATAATGAGATCCCATCTCTGCAAAAAAATTTGTACATGGGCATACACCTGTAGTCCCAGCTACTTGG