Transcript asmbl_170783

Sequence
Transcript Sequence for observation asmbl_170783 of TGE0002280:
GTCCGCTCCCTCCCGCTCGCAGCTTACTTAACCTGGCCCGGGCGGCGGAGGCGCTCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCCCGCTCCATGGCGCTCTTCGTGCGGCTGCTGGCTCTCGCCCTGGCTCTGGCCCTGGGCCCCGCCGCGACCCTGGCGGGTCCCGCCAAGTCGCCCTACCAGCTGGTGCTGCAGCACAGCAGGCTCCGGGGCCGCCAGCACGGCCCCAACGTGTGTGCTGTGCAGAAGGTTATTGGCACTAATAGGAAGTACTTCACCAACTGCAAGCAGTGGTACCAAAGGAAAATCTGTGGCAAATCAACAGTCATCAGCTACGAGTGCTGTCCTGGATATGAAAAGGTCCCTGGGGAGAAGGGCTGTCCAGCAGCCCTACCACTCTCAAACCTTTACGAGACCCTGGGAGTCGTTGGATCCACCACCACTCAGCTGTACACGGACCGCACGGAGAAGCTGAGGCCTGAGATGGAGGGGCCCGGCAGCTTCACCATCTTCGCCCCTAGCAACGAGGCCTGGGCCTCCTTGCCAGCTGAAGTGCTGGACTCCCTGGTCAGCAATGTCAACATTGAGCTGCTCAATGCCCTCCGCTACCATATGGTGGGCAGGCGAGTCCTGACTGATGAGCTGAAACACGGCATGACCCTCACCTCTATGTACCAGAATTCCAACATCCAGATCCACCACTATCCTAATGGGATTGTAACTGTGAACTGTGCCCGGCTGCTGAAAGCCGACCACCATGCAACCAACGGGGTGGTGCACCTCATCGATAAGGTCATCTCCACCATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCAAGACACTATTTGAATTGGCTGCAGAGTCTGATGTGTCCACAGCCATTGACCTTTTCAGACAAGCCGGCCTCGGCAATCATCTCTCTGGAAGTGAGCGGTTGACCCTCCTGGCTCCCCTGAATTCTGTATTCAAAGATGGAACCCCTCCAATTGATGCCCATACAAGGAATTTGCTTCGGAACCACATAATTAAAGACCAGCTGGCCTCTAAGTATCTGTACCATGGACAGACCCTGGAAACTCTGGGCGGCAAAAAACTGAGAGTTTTTGTTTATCGTAATAGCCTCTGCATTGAGAACAGCTGCATCGCGGCCCACGACAAGAGGGGGAGGTACGGGACCCTGTTCACGATGGACCGGGTGCTGACCCCCCCAATGGGGACTGTCATGGATGTCCTGAAGGGAGACAATCGCTTTAGCATGCTGGTAGCTGCCATCCAGTCTGCAGGACTGACGGAGACCCTCAACCGGGAAGGAGTCTACACAGTCTTTGCTCCCACAAATGAAGCCTTCCGAGCCCTGCCACCAAGAGAACGGAGCAGACTCTTGGGAGATGCCAAGGAACTTGCCAACATCCTGAAATACCACATTGGTGATGAAATCCTGGTTAGCGGAGGCATCGGGGCCCTGGTGCGGCTAAAGTCTCTCCAAGGTGACAAGCTGGAAGTCAGCTTGAAAAACAATGTGGTGAGTGTCAACAAGGAGCCTGTTGCCGAGCCTGACATCATGGCCACAAATGGCGTGGTCCATGTCATCACCAATGTTCTGCAGCCTCCAGCCAACAGACCTCAGGAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGGCTTCCCAGAGGTCTGTGCGACTAGCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAGCTTGAAGCACTACAGGAGGAATGCACCACGGCAGCTCTCCGCCAATTTCTCTCAGATTTCCACAGAGACTGTTTGAATGTTTTCAAAACCAAGTATCACACTTTAATGTACATGGGCCGCACCATAATGAGATGTGAGCCTTGTGCATGTGGGGGAGGAGGGAGAGAGATGTACTTTTTAAATCATGTTCCCCCTAAACATGGCTGTTAACCCACTGCATGCAGAAACTTGGATGTCACTGCCTGACATTCACTTCCAGAGAGGACCTATCCCAAATGTGGAATTGACTGCCTATGCCAAGTCCCTGGAAAAGGAGCTTCAGTATTGTGGGGCTCATAAAACATGAATCAAGCAATCCAGCCTCATGGGAAGTCCTGGCACAGTTTTTGTAAAGCCCTTGCACAGCTGGAGAAATGGCATCATTATAAGCTATGAGTTGAAATGTTCTGTCAAATGTGTCTCACATCTACACGTGGCTTGGAGGCTTTTATGGGGCCCTGTCCAGGTAGAAAAGAAATGGTATGTAGAGCTTAGATTTCCCTATTGTGACAGAGCCATGGTGTGTTTGTAATAATAAAACCAAAGAAACATACGTCCTGTGTGCATGGTACAGTGTGCTGACCTGAGGCCGTCATGCTCCTCCACACCTCAATTCTGCTCTGGAGAAGCTCAGAAAGGAGCCCCGAGG