Transcript asmbl_137947

Sequence
Transcript Sequence for observation asmbl_137947 of TGE0057102:
CCCAACTTTGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGCAGAGTTGACACGGAACCCCAAAGCAAGGAGGAGGGCTCGGGCCCGAGACCGTTCACCTCCCCTTATCCCTGTTCCCCTCTTCAGGATGGAGCTGACCTCAAGGGAAAGAGGGAGGGGACAGCCTCTGCCCTGGGAACTTCGACTGGGCCTACTGCTAAGCGTGCTGGCTGCCACACTGGCACAGGCCCCTGCCCCGGATGTGCCTGGCTGTTCCAGGGGAAGCTGCTACCCCGCCACGGGCGACCTGCTGGTGGGCCGAGCTGACAGACTGACTGCCTCATCCACTTGTGGCCTGAATGGCCCCCAGCCCTACTGCATCGTCAGTCACCTGCAGGACGAAAAGAAGTGCTTCCTTTGTGACTCCCGGCGCCCCTTCTCTGCTAGAGACAACCCACACAGCCATCGCATCCAGAATGTAGTCACCAGCTTTGCACCACAGCGGCGGGCAGCCTGGTGGCAGTCAGAGAATGGTATCCCTGCGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTTCATTTCACACACCTCATTATGACCTTCAAGACATTTCGCCCTGCTGCCATGCTGGTGGAACGCTCAGCAGACTTTGGCCGCACCTGGCATGTGTACCGATATTTCTCCTATGACTGTGGGGCTGACTTCCCAGGAGTCCCACTAGCACCCCCACGGCACTGGGATGATGTAGTCTGTGAGTCCCGCTACTCAGAGATTGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTGGACCCTGCCATCCCTATCCCAGACCCCTACAGCTCACGGATTCAGAACCTGTTGAAGATCACCAACCTACGGGTGAACCTGACTCGTCTACACACGTTGGGAGACAACCTACTCGACCCACGGAGGGAGATCCGAGAGAAGTACTACTATGCCCTCTATGAGCTGGTTGTACGTGGCAACTGCTTCTGCTACGGACACGCCTCAGAGTGTGCACCCGCCCCAGGGGCACCAGCCCATGCTGAGGGCATGGTGCACGGAGCTTGCATCTGCAAACACAACACACGTGGCCTCAACTGCGAGCAGTGTCAGGATTTCTATCGTGACCTGCCCTGGCGTCCGGCTGAGGACGGCCATAGTCATGCCTGTAGGAAGTGTGAGTGCCATGGGCACACCCACAGCTGCCACTTCGACATGGCCGTATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGATGGATGTCAGCATAACACAGCTGGGCGCCACTGTGAGCTCTGTCGGCCCTTCTTCTACCGTGACCCAACCAAGGACCTGCGGGATCCGGCTGTGTGCCGCTCCTGTGATTGTGACCCCATGGGTTCTCAAGACGGTGGTCGCTGTGATTCCCATGATGACCCTGCACTGGGACTGGTCTCCGGCCAGTGTCGCTGCAAAGAACATGTGGTGGGCACTCGCTGCCAGCAATGCCGTGATGGCTTCTTTGGGCTCAGCATCAGTGACCGTCTGGGCTGCCGGCGATGTCAATGTAATGCACGGGGCACAGTGCCTGGGAGCACTCCTTGTGACCCCAACAGTGGATCCTGTTACTGCAAACGTCTAGTGACTGGACGTGGATGTGACCGCTGCCTGCCTGGCCACTGGGGCCTGAGCCACGACCTGCTCGGCTGCCGCCCCTGTGACTGCGACGTGGGTGGTGCTTTGGATCCCCAGTGTGATGAGGGCACAGGTCAATGCCACTGCCGCCAGCACATGGTTGGGCGACGCTGTGAGCAGGTGCAACCTGGCTACTTCCGGCCCTTCCTGGACCACCTAATTTGGGAGGCTGAGGACACCCGAGGGCAGGTGCTCGATGTGGTGGAGCGCCTGGTGACCCCCGGGGAAACTCCATCCTGGACTGGCTCAGGCTTCGTGCGGCTACAGGAAGGTCAGACCCTGGAGTTCCTGGTGGCCTCTGTGCCGAAGGCTATGGACTATGACCTGCTGCTGCGCTTAGAGCCCCAGGTCCCTGAGCAATGGGCAGAGTTGGAACTGATTGTGCAGCGTCCAGGGCCTGTGCCTGCCCACAGCCTGTGTGGGCATTTGGTGCCCAAGGATGATCGCATCCAAGGGACTCTGCAACCACATGCCAGGTACTTGATATTTCCTAATCCTGTCTGCCTTGAGCCTGGTATCTCCTACAAGCTGCATCTGAAGCTGGTACGGACAGGGGGAAGTGCCCAGCCTGAGACTCCCTACTCTGGACCTGGCCTGCTCATTGACTCGCTGGTGCTGCTGCCCCGTGTCCTGGTGCTAGAGATGTTTAGTGGGGGTGATGCTGCTGCCCTGGAGCGCCAGGCCACCTTTGAACGCTACCAATGCCATGAGGAGGGTCTGGTGCCCAGCAAGACTTCTCCCTCTGAGGCCTGCGCACCCCTCCTCATCAGCCTGTCCACCCTCATCTACAATGGTGCCCTGCCATGTCAGTGCAACCCTCAAGGTTCACTGAGTTCTGAGTGCAACCCTCATGGTGGTCAGTGCCTGTGCAAGCCTGGAGTGGTTGGGCGCCGCTGTGACCTCTGTGCCCCTGGCTACTATGGCTTTGGCCCCACAGGCTGTCAAGGTACTCTTCTGCCCCTTGTTCCCTCCTATGCTTCTCTCTCCTTCCCATTACTGTTCTCTCTCCTCCTTCTGGACCTGCTGCTGGTTTCCTCAAACTAAGTCTTGGACCCTCTACTCTCAACCTGGGTCAGTTGTAGTTCTCTTCCATTTCCTGACCTTCCCACCTAGACTCCCACTACTCACACTCCCCTGAGACCCTCCCCCACCCACACTCCCCTCAGACCCCCTCCCCTGGCTCTGGCTCAGCTCTGCCTTGCTCCTAGCCTGCCAGTGCAGCCACGAGGGGGCACTCAGCAGTCTCTGTGAAAAGACCAGTGGGCAATGTCTCTGTCGAACTGGTGCCTTTGGGCTTCGCTGTGACCGCTGCCAGCGTGGCCAGTGGGGATTCCCTAGCTGCCGGCCATGTGTCTGCAATGGGCATGCAGATGAGTGCAACACCCACACAGGCGCTTGCCTGGGCTGCCGTGATCACACAGGGGGTGAGCACTGTGAAAGGTGCATTGCTGGTTTCCACGGGGACCCACGGCTGCCATATGGGGGCCAGTGCCGGCCCTGTCCCTGTCCTGAAGGCCCTGGGAGCCAACGGCACTTTGCTACTTCTTGCCACCAGGATGAATATTCCCAGCAGATTGTGTGCCACTGCCGGGCAGGCTATACGGGGCTGCGATGTGAAGCTTGTGCCCCTGGGCACTTTGGGGACCCATCAAGGCCAGGTGGCCGGTGCCAACTGTGTGAGTGCAGTGGGAACATTGACCCAATGGATCCTGATGCCTGTGACCCCCACACGGGGCAATGCCTGCGCTGTTTACACCACACAGAGGGTCCACACTGTGCCCACTGCAAGCCTGGCTTCCATGGGCAGGCTGCCCGACAGAGCTGTCACCGCTGCACATGCAACCTGCTGGGCACAAATCCGCAGCAGTGCCCATCTCCTGACCAGTGCCACTGTGATCCAAGCAGTGGGCAGTGCCCATGCCTCCCCAATGTCCAGGGCCCTAGCTGTGACCGCTGTGCCCCCAACTTCTGGAACCTCACCAGTGGCCATGGTTGCCAGCCTTGTGCCTGCCACCCAAGCCGGGCCAGAGGCCCCACCTGCAACGAGTTCACAGGGCAGTGCCACTGCCGTGCCGGCTTTGGAGGGCGGACTTGTTCTGAGTGCCAAGAGCTCCACTGGGGAGACCCTGGGTTGCAGTGCCATGCCTGTGATTGTGACTCTCGTGGAATAGATACACCTCAGTGTCACCGCTTCACAGGTCACTGCAGCTGCCGCCCAGGGGTGTCTGGTGTGCGCTGTGACCAGTGTGCCCGTGGCTTCTCAGGAATCTTTCCTGCCTGCCATCCCTGCCATGCATGCTTCGGGGATTGGGACCGAGTGGTGCAGGACTTGGCAGCCCGTACACAGCGCCTAGAGCAGCGGGCGCAGGAGTTGCAACAGACGGGTGTGCTGGGTGCCTTTGAGAGCAGCTTCTGGCACATGCAGGAGAAGCTGGGCATTGTGCAGGGCATCGTAGGTGCCCGCAACACCTCAGCCGCCTCCACTGCACAGCTTGTGGAGGCCACAGAGGAGCTGCGGCGTGAAATTGGGGAGGCCACTGAGCACCTGACTCAGCTCGAGGCAGACCTGACAGATGTGCAAGATGAGAACTTCAATGCCAACCATGCACTAAGTGGTCTGGAGCGAGATAGGCTTGCACTTAATCTCACACTGCGGCAGCTCGACCAGCATCTTGACTTGCTCAAACATTCAAACTTCCTGGGTGCCTATGACAGCATCCGGCATGCCCATAGCCAGTCTGCAGAGGCAGAACGTCGTGCCAATACCTCAGCCCTGGCAGTACCTAGCCCTGTGAGCAACTCGGCAAGTGCTCGGCATCGGACAGAGGCACTGATGGATGCTCAGAAGGAGGACTTCAACAGCAAACACATGGCCAACCAGCGGGCACTTGGCAAGCTCTCTGCCCATACCCACACCCTGAGCCTGACAGACATAAATGAGCTGGTGTGTGGGGCACCAGGGGATGCACCCTGTGCTACAAGCCCTTGTGGGGGTGCCGGCTGTCGAGATGAGGATGGGCAGCCGCGCTGTGGGGGCCTCAGCTGCAATGGGGCAGCGGCTACAGCAGACCTAGCACTGGGCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGGCACTGGCAGAAGGTGGTAGCATCCTCAGCAGAGTGGCTGAGACTCGTCGGCAGGCAAGCGAGGCACAGCAGCGGGCCCAGGCAGCCCTGGACAAGGCTAATGCTTCCAGGGGACAGGTGGAACAGGCCAACCAGGAACTTCAAGAACTTATCCAGAGTGTGAAGGACTTCCTCAACCAGGAGGGGGCTGATCCTGATAGCATTGAAATGGTGGCCACACGGGTGCTAGAGCTCTCCATCCCAGCTTCAGCTGAGCAGATCCAGCACCTGGCGGGTGCGATTGCAGAGCGAGTCCGGAGCCTGGCAGATGTGGATGCGATCCTGGCACGTACTGTAGGAGATGTGCGTCGTGCCGAGCAGCTACTGCAGGATGCACGGCGGGCAAGGAGCTGGGCTGAGGATGAGAAACAGAAGGCAGAGACAGTACAGGCAGCACTGGAGGAGGCCCAGCGGGCACAGGGTATTGCCCAGGGTGCCATCCGGGGGGCAGTGGCTGACACACGGGACACAGAGCAGACCCTGTACCAGGTACAGGAGAGGATGGCAGGTGCAGAGCGGGCACTGAGCTCTGCAGGTGAAAGGGCTCGGCAGTTGGATGCTCTCCTGGAGGCTCTGAAATTGAAACGGGCAGGAAATAGTCTGGCAGCCTCTACAGCAGAAGAAACGGCAGGCAGTGCCCAGGGTCGTGCCCAGGAGGCTGAGCAGCTGCTACGCGGTCCTCTGGGTGATCAGTACCAGACGGTGAAGGCCCTAGCTGAGCGCAAGGCCCAAGGTGTGCTGGCTGCACAGGCAAGGGCAGAACAACTGCGGGATGAGGCTCGGGACCTGTTGCAAGCCGCTCAGGACAAGCTGCAGCGGCTACAGGAATTGGAAGGCACCTATGAGGAAAATGAGCGGGCACTGGAGAGTAAGGCAGCCCAGTTGGACGGGTTGGAGGCCAGGATGCGCAGCGTGCTTCAAGCCATCAACTTGCAGGTGCAGATCTACAACACCTGCCAGTGACCCCTGCCCAAGGCCTACCCCAGTTCCTAGCACTGCCCCACATGCATGTCTGCCTATGCACTGAAGAGCTCTTGGCCCGGCAGGGCCCCCAATAAACCAGTGTGAACCCCCA