Transcript asmbl_77351

Sequence
Transcript Sequence for observation asmbl_77351 of TGE0058231:
CAGGCGCGCGCGCGCGGGAGGGCGGCAACCTCGGCGCTGTGCGCAGGCGCGGCGGGCAGTGCGCAGGCGCGGGCGGAGGGCGGGCTGAAGCAGCTGAAGCGGCGGTAGCGGCGGCGGCTCGGGCAGAGGGGCGGGAGCTGAGGCGGGAGCGGACAGGCTGGTGGGCGAGCGAGAGGCGGCGGAATGGTGGACTACCACGCGGCGAACCAGTCGTACCAGTACGGCCCCAGCAGCGCGGGCAATGGCGCTGGCGGCGGGGGCAGCATGGGCGACTACATGGCCCAGGAGGACGACTGGGACCGGGACCTGCTGCTGGACCCGGCCTGGGAGAAGCAGCAGCGCAAGACCTTCACGGCATGGTGCAACTCCCACCTGCGGAAGGCAGGCACACAGATCGAGAACATTGATGAGGACTTCCGAGACGGGCTCAAGCTCATGCTGCTCCTGGAGGTCATATCAGGGGAGCGGTTACCTAAGCCGGAGCGGGGGAAGATGAGAGTGCACAAAATCAACAATGTGAACAAAGCGCTGGACTTTATTGCCAGCAAAGGCGTCAAGCTGGTCTCCATCGGGGCAGAAGAGATTGTGGACGGCAACGCAAAGATGACCCTGGGAATGATCTGGACCATCATCCTTAGGTTCGCCATCCAGGACATCTCCGTGGAAGAGACCTCGGCCAAGGAAGGGCTCCTTCTCTGGTGCCAGAGAAAGACAGCCCCGTATAAGAACGTCAATGTGCAGAACTTCCACATCAGCTGGAAGGATGGTCTTGCCTTCAATGCCCTGATCCACCGGCACAGACCAGAGCTGATTGAGTATGACAAGCTGAGGAAGGACGACCCTGTCACCAACCTGAACAATGCCTTCGAAGTGGCTGAGAAATACCTCGACATCCCCAAGATGCTGGATGCAGAGGACATCGTGAACACGGCCCGGCCCGACGAGAAGGCCATAATGACCTATGTGTCCAGCTTCTACCATGCCTTTTCAGGAGCGCAGAAGGCTGAAACTGCCGCCAACCGGATCTGTAAGGTGCTGGCTGTCAACCAAGAGAACGAGCACCTGATGGAGGACTACGAGAAGCTGGCCAGCGACCTCCTGGAGTGGATCCGGCGCACCATCCCCTGGCTGGAGGACCGTGTGCCCCAAAAGACTATCCAGGAGATGCAGCAGAAGCTGGAGGACTTCCGCGACTACCGGCGTGTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGCCTCAGCAACCGGCCCGCCTTCATGCCCTCCGAGGGCAAGATGGTCTCGGACATCAACAATGGCTGGCAGCACTTGGAGCAGGCTGAGAAGGGCTACGAGGAGTGGCTGCTGAATGAGATCCGCAGGCTGGAGCGGCTCGACCACCTGGCAGAGAAGTTCCGGCAGAAGGCCTCCATCCACGAGGCCTGGACTGACGGGAAGGAAGCCATGCTGAAGCACCGGGACTACGAGACGGCCACACTATCGGACATCAAAGCCCTCATTCGCAAGCACGAGGCCTTCGAGAGCGACCTGGCTGCGCACCAGGACCGCGTGGAGCAGATCGCCGCCATTGCCCAGGAGCTCAACGAGCTGGATTACTACGACTCCCACAATGTCAACACCCGGTGCCAGAAGATCTGTGACCAGTGGGACGCCCTCGGCTCTCTGACACATAGTCGCAGGGAAGCCCTGGAGAAAACAGAGAAGCAGCTGGAGGCCATCGACCAGCTGCACCTGGAATACGCCAAGCGCGCGGCCCCCTTCAACAACTGGATGGAGAGCGCCATGGAGGACCTCCAGGACATGTTCATCGTCCATACCATCGAGGAGATTGAGGGCCTGATCTCAGCCCATGACCAGTTCAAGTCCACCCTGCCGGACGCCGATAGGGAGCGCGAGGCCATCCTGGCCATCCACAAGGAGGCCCAGAGGATCGCTGAGAGCAACCACATCAAGCTGTCGGGCAGCAACCCCTACACCACCGTCACCCCGCAAATCATCAACTCCAAGTGGGAGAAGGTGCAGCAGCTGGTGCCAAAACGGGACCATGCCCTCCTGGAGGAGCAGAGCAAGCAGCAGTCCAACGAGCACCTGCGCCGCCAGTTCGCCAGCCAGGCCAATGTTGTGGGGCCCTGGATCCAGACCAAGATGGAGGAGATCGGGCGCATCTCCATTGAGATGAACGGGACCCTGGAGGACCAGCTGAGCCACCTGAAGCAGTATGAACGCAGCATCGTGGACTACAAGCCCAACCTGGACCTGCTGGAGCAGCAGCACCAGCTCATCCAGGAGGCCCTCATCTTCGACAACAAGCACACCAACTATACCATGGAGCACATCCGCGTGGGCTGGGAGCAGCTGCTCACCACCATTGCCCGCACCATCAACGAGGTGGAGAACCAGATCCTCACCCGCGACGCCAAGGGCATCAGCCAGGAGCAGATGCAGGAGTTCCGGGCGTCCTTCAACCACTTCGACAAGGTGAGCAGCCTGCCACCTCCTCGGCCTCTCCCCTCCCGCCGTTGCCGTACCAGCCCACACCTTCGTCTCTGCATCTGTTCGTCCATTCCCATCACAGTTGCTGAGCGTCGGCCGCCACTCCCAGGGCCAGCAGGGCCCTGCCACTGTCAGGGTGTAGGTGTGCGGCACCAAGACCCCAGCCTGGGCCACTTCACACGCACAGGCAGGGGGCCGGAGGTCCCAAGTCCTGCCTTCTGGGGTGGCATCCTCACCACCCCCAGGGCAGATGAAGTCTCAGCACACCCAGGCTTTGCGACCCGGTCTGTGAACCTGGACACAGACACCCCGCACAGTGCTTTTAGAATTCAGATTTGGTCCGGCAGCCTCATCAGAGGGGCCCTGAGCGCCAGAGTTTGCTGCCATCCCCAGCCCACCCCTGCCGGGCTGACGGACTGAGAAGTGTGCAGCCTCAGCTCTGCACCTGGCGCCCCCAGGACAGGATACAGTCCCCTCTGTCCCACTCCAAATCCCAAAGGCAAGGAGAACCCCCCCCCCGACCCTCCACCAGTCCTGGGACTTGTCCTCAGTTCTGTAGCATCCAGCTGCCACCCCTGCTGTGGGCAGAGAGGTCGGGGAGGCCTCTGCCTTCCTTTGAGCTTCCGAGGTTGGGGAAAGGATGAAAGGGGCCCGTGCCGCCCCCGACCCCACGTGTCCCTGGCCATCTCCTTGTCCATGTTGCCTCTAACTCTGTGTTTCCCTCCCCTACGTGTCCCTTCCCCCTGCCCTCTGCATGTGACCCCGATCCCTCATCCTGGTCTCCACGCCGCCCCTCCCGCACACCTGCCTTCGGATGGCCCCGGCAGGATCATGGCGGGGCGCTGGGGCCCGAGGAGTTCAAGGCCTGCCTCATCAGCCTGGGCTACGACGTGGAGAACGACCGGCAGGGTGAGGCCGAGTTCAACCGCATCATGAGCCTGGTCGACCCCAACCATAGCGGCCTTGTGACCTTCCAAGCCTTCATCGACTTCATGTCGCGGGAGACCACCGACACGGACACGGCTGACCAGGTCATCGCTTCCTTCAAGGTCTTAGCAGGGGACAAGAACTTCATCACAGCTGAGGAGCTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCGCCATACCAGGGCCCTGACGCCGTGCCCGGTGCCCTCGACTACAAGTCCTTCTCCACGGCCTTGTATGGCGAGAGCGACCTGTGAGGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCTGTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGG