Transcript asmbl_74420

Sequence
Transcript Sequence for observation asmbl_74420 of TGE0000954:
TGTCGCCCCTCCGTGAAGTCAGACCCACTCTGCGGGCCAAGAAAGGTGACCGGGCTTCCTTCCGGCTTGCTAAGCAGAGGCCGGAAGCGGTGGTTTTTAGCGGCTCTCTGGGTAGCAGGGTGGTGTGATAGCGGCAGCGAGGGGCTCGGAGAGGTGCTCGGATTCTCGTAGCTGTGCCGGCCCACAATGATTCTGAGCTAAAACACAAAATAAAAACCAGATTCATTGCCACCAGCGCTCACCTCGCCTGACTTAAAAAAAAGGACTTAACCACCACCATGTCGAGCAAAAGAACAAAGACCAAGACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTGCTATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGGTTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCATTGGGGAAGAATCCAACTGATGAGTATCTAGATGCCATGATGAATGAGGCTCCAGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGTGAGAAGTTAAATGGCACAGATCCTGAAGATGTCATCAGAAATGCCTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATACAGGAAGATTACTTGAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGATAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGAAACATGGAGCCAAAGACAAAGATGACTGAAATAACTTCAAATTCCAGCCAAACGTTCCTTGTTGCCACTTTGGGTATTCTGAGATTTTCTCTTGCATGCCCTTAGCTTTACAGCTTTTGCATTTCCTGTTGTATTTATTCTCAGCCATTTTGGGCATATGTATCTTTATAATCAGACTGGAAACGGGACTTTCTATTAATATCATTTTCAGAATAAAAAATAGGATAATTTAACCTACCAGCCCTTCTCCCCCAATAACTGTGGTCTATACAGAGTCAATATATTTTTTCAGAGAAAGTTATTCGCTCGATTTTTTCTGAATCATAATTAAACTTTATGATAAAATA