Transcript asmbl_56938

Sequence
Transcript Sequence for observation asmbl_56938 of TGE0000590:
TTATCAAACTGATTTCTCCCTTTTTGTATGCCGGATGCTGCATGAGTCTGAAACACCAATAAACGGAGACTGCATGAGACTCGCCTCCAATCTCGGTTGGTTCCTGCGTTCGTCCCGCCGGCCCGGCGGTGCTGCCTTTCTGGCAGAACCTTACTGGGTGGTATACGCATGCGACTTCCCGGTGGCCATCTTTACTGTGGGCTGAAGCCTGTGCGCTTACTCGCGCATGTGCAAGCCTTCCCTCGCTTTCCTCTTCCAAGTAGCCTTGCCTAGAGCGGAGCCTCCCGCGCCATTTCTGTGCGCCTGCGTAGCGTGACCCTGCGCAGCCTGGGAGGCGGGTCTTAGCTCCAGGTGCGTACGGCATCTGACTTGACGTGGCCCACAACTGAAAGGTCTGGGGAGAAGGCGCCGTGTCCGGGTGTGGAGAGGGGCGTCGTGGAAGCGAGAAGAGTGGCCCGTCCCTCTCCTCCCCCTTTCCCTCTTTCGGAAAGTGGTTTCTGCGGGGCCCGGGAGCCTCGGAGTACCGAACCTCGATCTCCGGGGCGGGGTCCTTGGTGGGGACTGAGCGCCCCCTCCCGGGGACGGGCGGTCTGGCCGCGGAGTCCCCTGCGGGAGCGTGATTGGCTGGAAACGGTCCCGAACCCCCAGGGGAGCCCGATCCCTGGGGGACCCTGGCTTCGGACTCCAGTATCTGTCGTCGCAGGGTCCCTGCCCTAGTGGCCTATGTCCCTTGCTCGGGGCCATGGAGACACTGCGGCCAGTACGGCGGCGCCTCTGTCTGAAGAAGGGGAAGTGACCTCCGGCCTCCAGGCTCTGGCCGTGGAGGATACCGGAGGCCCCTCTGCCTCGGCCGGTAAGGCCGAGGACGAGGGGGAAGGAGGCCGAGAGGAGACCGAGCGTGAGGGGTCCGGGGGCGAGGAGGCGCAGGGAGAAGTCCCCAGCGCTGGGGGAGAAGAGCCTGCCGAGGAGGACTCCGAGGACTGGTGCGTGCCCTGCAGCGACGAGGAGGTGGAGCTGCCTGCGGATGGGCAGCCCTGGATGCCCCCGCCCTCCGAAATCCAGCGGCTCTATGAACTGCTGGCTGCCCACGGTACTCTGGAGCTGCAAGCCGAGATCCTGCCCCGCCGGCCTCCCACGCCGGAGGCCCAGAGCGAAGAGGAGAGATCCGATGAGGAGCCGGAGGCCAAAGAAGAGGAAGAGGAAAAACCACACATGCCCACGGAATTTGATTTTGATGATGAGCCAGTGACACCAAAGGACTCCCTGATTGACCGGAGACGCACCCCAGGAAGCTCAGCCCGGAGCCAGAAACGGGAGGCCCGCCTGGACAAGGTGCTGTCGGACATGAAGAGACACAAGAAGCTGGAGGAGCAGATCCTTCGTACCGGGAGGGACCTCTTCAGCCTGGACTCGGAGGACCCCAGCCCCGCCAGCCCCCCACTCCGATCCTCCGGGAGTAGTCTCTTCCCTCGGCAGCGGAAATACTGATTCCCACTGCTCCTGCCTCTAGGGTGCAGTGTCCGTACCTGCTGGAGCCTGGGCCCTCCTTCCCCAGCCCAGACATTGAGAAACTTGGGAAGAAGAGAGAAACCTCAAGCTCCCAAACAGCACGTTGCGGGAAAGAGGAAGAGAGAGTGTGAGTGTGTGTGTGTGTTTTTTCTATTGAACACCTGTAGAGTGTGTGTGTGTGTTTTCTATTGAACACCTATAGAGAGAGTGTGTGTGTTTTCTATTGAACATCTATATAGAGAGAGTGTGTGAGTGTGTGTTTTCTATTGAACACCTATTCAGAGACCTGGACTGAATTTTCTGAGTCTGAAATAAAAGATGCAGAGCTATCATCTCTTAAAAGGAGGGGCTGTAGCTGTAGCTCAACAGTTAGGCCCCACTTGAAGGGAGAGGCAGAATTGTACTCACCCAGATTGGAAAATGAAAGCCAGATGGGTAGAGGTGCCCTCAGTTAGCACCTGTCCCATCTCGGGCCCTCCAACTCCTCCCAGTCCCACTCCAGTGCAGCCAGCTGGCTCCAAGGTAGAAACCCATGAGCACTCAGGGAGCAGTGTGCCTTCAGCTGCAGCAGAAGCAGCCCGGAGGATAAAATGAGAACCAGCTGCACACGGGCCCTTTAACTCCCAAGCCCCACCCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCATCTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATGCTCCCCAGGTTCATCCTGTGTCGTCTCCCCCACCTACCAGTCATCTTCTTGTGAGCCCTGGGCTTAGGAGTCACCATGGCAACTGAAGAGTTCATCATCCGCATCCCCCCATACCACTATATCCATGTGCTGGACCAGAACAGCAACGTGTCCCGTGTGGAGGTCGGGCCAAAGACCTACATCCGGCAGGACAATGAGAGGGTACTGTTTGCCCCCATGCGCATGGTGACCGTCCCCCCACGTCACTACTGCACAGTGGCCAACCCTGTGTCTCGGGATGCCCAGGGCTTGGTGCTGTTTGATGTCACAGGGCAAGTTCGGCTTCGCCACGCTGACCTCGAGATCCGGCTGGCCCAGGACCCCTTCCCCCTGTACCCAGGGGAGGTGCTGGAAAAGGACATCACACCCCTGCAGGTGGTTCTGCCCAACACTGCCCTCCATCTAAAGGCGCTGCTTGATTTTGAGGATAAAGATGGAGACAAGGTGGTGGCAGGAGATGAGTGGCTTTTCGAGGGACCTGGCACGTACATCCCCCGGAAGGAAGTGGAGGTCGTGGAGATCATTCAGGCCACCATCATCAGGCAGAACCAGGCTCTGCGGCTCAGGGCCCGCAAGGAGTGCTGGGACCGGGACGGCAAGGAGAGGGTGACAGGGGAAGAATGGCTGGTCACCACAGTAGGGGCGTACCTCCCAGCGGTGTTTGAGGAGGTTCTGGATTTGGTGGACGCCGTCATCCTTACGGAAAAGACAGCCCTGCACCTCCGGGCTCGGCGGAACTTCCGGGACTTCAGGGGAGTGTCCCGCCGCACTGGGGAGGAGTGGCTGGTAACAGTGCAGGACACAGAGGCCCACGTGCCAGATGTCCACGAGGAGGTGCTGGGGGTTGTGCCCATCACCACCCTGGGCCCCCACAACTACTGCGTGATTCTCGACCCTGTCGGACCGGATGGCAAGAATCAGCTGGGGCAGAAGCGCGTGGTCAAGGGAGAGAAGTCTTTTTTCCTCCAGCCAGGAGAGCAGCTGGAACAAGGCATCCAGGATGTGTATGTGCTGTCGGAGCAGCAGGGGCTGCTGCTGAGGGCCCTGCAGCCCCTGGAGGAGGGGGAGGATGAGGAGAAGGTCTCACACCAGGCTGGGGACCACTGGCTCATCCGCGGACCCCTGGAGTATGTGCCATCTGCCAAAGTGGAGGTGGTGGAGGAGCGCCAGGCCATCCCTCTAGACGAGAACGAGGGCATCTATGTGCAGGATGTCAAGACCGGAAAGGTGCGCGCTGTGATTGGAAGCACCTACATGCTGACCCAGGACGAAGTCCTGTGGGAGAAAGAGCTGCCTCCCGGGGTGGAGGAGCTGCTGAACAAGGGGCAGGACCCTCTGGCAGACAGGGGTGAGAAGGACACAGCTAAGAGCCTCCAGCCCTTGGCGCCCCGGAACAAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCGCATCATTCGCACTGCTGTCTTTGGCTTTGAGACCTCGGAAGCGAAGGGCCCCGATGGCATGGCCCTGCCCAGGCCCCGGGACCAGGCTGTCTTCCCCCAAAACGGGCTGGTGGTCAGCAGTGTGGACGTGCAGTCAGTGGAGCCTGTGGATCAGAGGACCCGGGACGCCCTGCAACGCAGCGTCCAGCTGGCCATCGAGATCACCACCAACTCCCAGGAAGCGGCGGCCAAGCATGAGGCTCAGAGACTGGAGCAGGAAGCCCGCGGCCGGCTTGAGCGGCAGAAGATCCTGGACCAGTCAGAAGCCGAGAAAGCTCGCAAGGAACTTTTGGAGCTGGAGGCTCTGAGCATGGCCGTGGAGAGCACCGGGACTGCCAAGGCGGAGGCCGAGTCCCGTGCGGAGGCAGCCCGGATTGAGGGAGAAGGGTCCGTGCTGCAGGCCAAGCTAAAAGCACAGGCCTTGGCCATTGAAACGGAGGCTGAGCTCCAGAGGGTCCAGAAGGTCCGAGAGCTGGAACTGGTCTATGCCCGGGCCCAGCTGGAGCTGGAGGTGAGCAAGGCTCAGCAGCTGGCTGAGGTGGAGGTGAAGAAGTTCAAGCAGATGACAGAGGCCATAGGCCCCAGCACCATCAGGGACCTTGCTGTGGCTGGGCCTGAGATGCAGGTAAAACTGCTCCAGTCCCTGGGCCTGAAATCAACCCTCATCACCGATGGCTCCACTCCCATCAACCTCTTCAACACAGCCTTTGGGCTGCTGGGGATGGGGCCCGAGGGTCAGCCCCTGGGCAGAAGGGTGGCCAGTGGGCCCAGCCCTGGGGAGGGGATATCCCCCCAGTCTGCTCAGGCCCCTCAAGCTCCTGGAGACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTGGGCATTTACAATTTCAACACTTTTCTC