Transcript asmbl_56937

Sequence
Transcript Sequence for observation asmbl_56937 of TGE0000590:
TTATCAAACTGATTTCTCCCTTTTTGTATGCCGGATGCTGCATGAGTCTGAAACACCAATAAACGGAGACTGCATGAGACTCGCCTCCAATCTCGGTTGGTTCCTGCGTTCGTCCCGCCGGCCCGGCGGTGCTGCCTTTCTGGCAGAACCTTACTGGGTGGTATACGCATGCGACTTCCCGGTGGCCATCTTTACTGTGGGCTGAAGCCTGTGCGCTTACTCGCGCATGTGCAAGCCTTCCCTCGCTTTCCTCTTCCAAGTAGCCTTGCCTAGAGCGGAGCCTCCCGCGCCATTTCTGTGCGCCTGCGTAGCGTGACCCTGCGCAGCCTGGGAGGCGGGTCTTAGCTCCAGGTGCGTACGGCATCTGACTTGACGTGGCCCACAACTGAAAGGTCTGGGGAGAAGGCGCCGTGTCCGGGTGTGGAGAGGGGCGTCGTGGAAGCGAGAAGAGTGGCCCGTCCCTCTCCTCCCCCTTTCCCTCTTTCGGAAAGTGGTTTCTGCGGGGCCCGGGAGCCTCGGAGTACCGAACCTCGATCTCCGGGGCGGGGTCCTTGGTGGGGACTGAGCGCCCCCTCCCGGGGACGGGCGGTCTGGCCGCGGAGTCCCCTGCGGGAGCGTGATTGGCTGGAAACGGTCCCGAACCCCCAGGGGAGCCCGATCCCTGGGGGACCCTGGCTTCGGACTCCAGTATCTGTCGTCGCAGGGTCCCTGCCCTAGTGGCCTATGTCCCTTGCTCGGGGCCATGGAGACACTGCGGCCAGTACGGCGGCGCCTCTGTCTGAAGAAGGGGAAGTGACCTCCGGCCTCCAGGCTCTGGCCGTGGAGGATACCGGAGGCCCCTCTGCCTCGGCCGGTAAGGCCGAGGACGAGGGGGAAGGAGGCCGAGAGGAGACCGAGCGTGAGGGGTCCGGGGGCGAGGAGGCGCAGGGAGAAGTCCCCAGCGCTGGGGGAGAAGAGCCTGCCGAGGAGGACTCCGAGGACTGGTGCGTGCCCTGCAGCGACGAGGAGGTGGAGCTGCCTGCGGATGGGCAGCCCTGGATGCCCCCGCCCTCCGAAATCCAGCGGCTCTATGAACTGCTGGCTGCCCACGGTACTCTGGAGCTGCAAGCCGAGATCCTGCCCCGCCGGCCTCCCACGCCGGAGGCCCAGAGCGAAGAGGAGAGATCCGATGAGGAGCCGGAGGCCAAAGAAGAGGAAGAGGAAAAACCACACATGCCCACGGAATTTGATTTTGATGATGAGCCAGTGACACCAAAGGACTCCCTGATTGACCGGAGACGCACCCCAGGAAGCTCAGCCCGGAGCCAGAAACGGGAGGCCCGCCTGGACAAGGTGCTGTCGGACATGAAGAGACACAAGAAGCTGGAGGAGCAGATCCTTCGTACCGGGAGGGACCTCTTCAGCCTGGACTCGGAGGACCCCAGCCCCGCCAGCCCCCCACTCCGATCCTCCGGGAGTAGTCTCTTCCCTCGGCAGCGGAAATACTGATTCCCACTGCTCCTGCCTCTAGGGTGCAGTGTCCGTACCTGCTGGAGCCTGGGCCCTCCTTCCCCAGCCCAGACATTGAGAAACTTGGGAAGAAGAGAGAAACCTCAAGCTCCCAAACAGCACGTTGCGGGAAAGAGGAAGAGAGAGTGTGAGTGTGTGTGTGTGTTTTTTCTATTGAACACCTGTAGAGTGTGTGTGTGTGTTTTCTATTGAACACCTATAGAGAGAGTGTGTGTGTTTTCTATTGAACATCTATATAGAGAGAGTGTGTGAGTGTGTGTTTTCTATTGAACACCTATTCAGAGACCTGGACTGAATTTTCTGAGTCTGAAATAAAAGATGCAGAGCTATCATCTCTTAAAAGGAGGGGCTGTAGCTGTAGCTCAACAGTTAGGCCCCACTTGAAGGGAGAGGCAGAATTGTACTCACCCAGATTGGAAAATGAAAGCCAGATGGGTAGAGGTGCCCTCAGTTAGCACCTGTCCCATCTCGGGCCCTCCAACTCCTCCCAGTCCCACTCCAGTGCAGCCAGCTGGCTCCAAGGTAGAAACCCATGAGCACTCAGGGAGCAGTGTGCCTTCAGCTGCAGCAGAAGCAGCCCGGAGGATAAAATGAGAACCAGCTGCACACGGGCCCTTTAACTCCCAAGCCCCACCCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCATCTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATTCATCTTCTTGTGAGCCCTGGGCTTAGGAGTCACCATGGCAACTGAAGAGTTCATCATCCGCATCCCCCCATACCACTATATCCATGTGCTGGACCAGAACAGCAACGTGTCCCGTGTGGAGGTCGGGCCAAAGACCTACATCCGGCAGGACAATGAGAGGGTACTGTTTGCCCCCATGCGCATGGTGACCGTCCCCCCACGTCACTACTGCACAGTGGCCAACCCTGTGTCTCGGGATGCCCAGGGCTTGGTGCTGTTTGATGTCACAGGGCAAGTTCGGCTTCGCCACGCTGACCTCGAGATCCGGCTGGCCCAGGACCCCTTCCCCCTGTACCCAGGGGAGGTGCTGGAAAAGGACATCACACCCCTGCAGGTGGTTCTGCCCAACACTGCCCTCCATCTAAAGGCGCTGCTTGATTTTGAGGATAAAGATGGAGACAAGGTGGTGGCAGGAGATGAGTGGCTTTTCGAGGGACCTGGCACGTACATCCCCCGGAAGGAAGTGGAGGTCGTGGAGATCATTCAGGCCACCATCATCAGGCAGAACCAGGCTCTGCGGCTCAGGGCCCGCAAGGAGTGCTGGGACCGGGACGGCAAGGAGAGGGTGACAGGGGAAGAATGGCTGGTCACCACAGTAGGGGCGTACCTCCCAGCGGTGTTTGAGGAGGTTCTGGATTTGGTGGACGCCGTCATCCTTACGGAAAAGACAGCCCTGCACCTCCGGGCTCGGCGGAACTTCCGGGACTTCAGGGGAGTGTCCCGCCGCACTGGGGAGGAGTGGCTGGTAACAGTGCAGGACACAGAGGCCCACGTGCCAGATGTCCACGAGGAGGTGCTGGGGGTTGTGCCCATCACCACCCTGGGCCCCCACAACTACTGCGTGATTCTCGACCCTGTCGGACCGGATGGCAAGAATCAGCTGGGGCAGAAGCGCGTGGTCAAGGGAGAGAAGTCTTTTTTCCTCCAGCCAGGAGAGCAGCTGGAACAAGGCATCCAGGATGTGTATGTGCTGTCGGAGCAGCAGGGGCTGCTGCTGAGGGCCCTGCAGCCCCTGGAGGAGGGGGAGGATGAGGAGAAGGTCTCACACCAGGCTGGGGACCACTGGCTCATCCGCGGACCCCTGGAGTATGTGCCATCTGCCAAAGTGGAGGTGGTGGAGGAGCGCCAGGCCATCCCTCTAGACGAGAACGAGGGCATCTATGTGCAGGATGTCAAGACCGGAAAGGTGCGCGCTGTGATTGGAAGCACCTACATGCTGACCCAGGACGAAGTCCTGTGGGAGAAAGAGCTGCCTCCCGGGGTGGAGGAGCTGCTGAACAAGGGGCAGGACCCTCTGGCAGACAGGGGTGAGAAGGACACAGCTAAGAGCCTCCAGCCCTTGGCGCCCCGGAACAAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCGCATCATTCGCACTGCTGTCTTTGGCTTTGAGACCTCGGAAGCGAAGGGCCCCGATGGCATGGCCCTGCCCAGGCCCCGGGACCAGGCTGTCTTCCCCCAAAACGGGCTGGTGGTCAGCAGTGTGGACGTGCAGTCAGTGGAGCCTGTGGATCAGAGGACCCGGGACGCCCTGCAACGCAGCGTCCAGCTGGCCATCGAGATCACCACCAACTCCCAGGAAGCGGCGGCCAAGCATGAGGCTCAGAGACTGGAGCAGGAAGCCCGCGGCCGGCTTGAGCGGCAGAAGATCCTGGACCAGTCAGAAGCCGAGAAAGCTCGCAAGGAACTTTTGGAGCTGGAGGCTCTGAGCATGGCCGTGGAGAGCACCGGGACTGCCAAGGCGGAGGCCGAGTCCCGTGCGGAGGCAGCCCGGATTGAGGGAGAAGGGTCCGTGCTGCAGGCCAAGCTAAAAGCACAGGCCTTGGCCATTGAAACGGAGGCTGAGCTCCAGAGGGTCCAGAAGGTCCGAGAGCTGGAACTGGTCTATGCCCGGGCCCAGCTGGAGCTGGAGGTGAGCAAGGCTCAGCAGCTGGCTGAGGTGGAGGTGAAGAAGTTCAAGCAGATGACAGAGGCCATAGGCCCCAGCACCATCAGGGACCTTGCTGTGGCTGGGCCTGAGATGCAGGTAAAACTGCTCCAGTCCCTGGGCCTGAAATCAACCCTCATCACCGATGGCTCCACTCCCATCAACCTCTTCAACACAGCCTTTGGGCTGCTGGGGATGGGGCCCGAGGGTCAGCCCCTGGGCAGAAGGGTGGCCAGTGGGCCCAGCCCTGGGGAGGGGATATCCCCCCAGTCTGCTCAGGCCCCTCAAGCTCCTGGAGACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTGGGCATTTACAATTTCAACACTTTTCTC