Transcript asmbl_25888

Sequence
Transcript Sequence for observation asmbl_25888 of TGE0000913:
GGCAAGATGGCGGACTTCCTGCCGTCGCGGTCCGTGCTGTCCGTGTGCTTCCCCGGCTGCCTGCTGACGAGTGGCGAGGCCGAGCAGCAACGCAAGTCCAAGGAGATCGACAAATGCCTGTCTCGGGAAAAGACCTATGTGAAGCGGCTGGTGAAGATCCTGCTGCTGGGCGCGGGCGAGAGCGGCAAGTCCACCTTCCTGAAGCAGATGCGGATCATCCACGGGCAGGACTTCGACCAGCGCGCGCGCGAGGAGTTCCGCCCCACCATCTACAGCAACGTGATCAAAGGTATGAGGGTGCTGGTTGATGCTCGAGAGAAGCTTCATATTCCCTGGGGAGACAACTCAAACCAACAACATGGAGATAAGATGATGTCGTTTGATACCCGGGCCCCCATGGCAGCCCAAGGAATGGTGGAAACAAGGGTTTTCTTACAATATCTTCCTGCTATAAGAGCATTATGGGCAGACAGCGGCATACAGAATGCCTATGACCGGCGTCGAGAATTTCAACTGGGTGAATCTGTAAAATATTTCCTGGATAACTTGGATAAACTTGGAGAACCAGATTATATTCCATCACAACAAGATATTCTGCTTGCCAGAAGACCCACCAAAGGCATCCATGAATACGACTTTGAAATAAAAAATGTTCCTTTCAAAATGGTTGATGTAGGTGGTCAGAGATCAGAAAGGAAACGTTGGTTTGAATGTTTCGACAGTGTGACATCAATACTTTTCCTTGTTTCCTCAAGTGAATTTGACCAGGTGCTTATGGAAGATCGACTGACCAATCGCCTTACAGAGTCTCTGAACATTTTTGAAACAATCGTCAATAACCGGGTTTTCAGCAATGTCTCCATAATTCTGTTCTTAAACAAGACAGACTTGCTTGAGGAGAAGGTGCAAATTGTGAGCATCAAAGACTATTTCCTAGAATTTGAAGGGGATCCCCACTGCTTAAGAGACGTCCAAAAATTCCTGGTGGAATGTTTCCGGAACAAACGCCGGGACCAGCAACAGAAGCCCTTATACCACCACTTCACCACTGCTATCAACACGGAGAACATCCGCCTTGTTTTCCGTGACGTGAAGGATACTATTCTGCATGACAACCTCAAGCAGCTTATGCTACAGTGATGTACAAAAGACTTGCTGTTTTAATATCTTTTTGTGTTTTTGATGTTTTCTGTTTGTTTTGTTTTTTAAAATAGCAGTTTACAACCAGAATTAGAACAATCTTAATTCTACGTTTAACTTCTTGAAAATCTTAGTACTTTTTCTGCGGCCTTTGGTTTGTGGCTGAAAGCTGTTGAGTGACTCATCGCCAAGATTTGCTGTAATGCAGGCTTTGATCTGTTTCACCATGGCTTCTATTCAAGTCCAGTTAAAACCTCCCAGCTGACCTCAGACTAGGCATATTTCAGGCTTTAAATTATTCTACTTTCCAAACTGAATTCTCCTGCAGTGCCAAGTATCAAAGGTGTCCTTAAATACTTGTAGGGATGAGGTTAGGAATATTCAGTTCCAAAACAAGATATCTTCTGTCCGCCTTACATATAGCAGTGACACTTGTTGCCTAACTTTATGGTGACCTCCTATTTTGTAAGGGCTGTTAGAAGTTCTATCTAAGAAATGGCATTCTGTAGGTTTATAGAAGGTTTAGCCTTCATATTTTAATTGCTTGTATACACAACAGCTGTTTTGCTTTTAGATTTCTGTGTTTCTGAAGGTAATGTTCTTCCTGTTTTCAAGTTTACATAAGGATCTTTGGTCTGATGCTGATGAAGAGTTCACAGGTGGTATGGGAGAGCAAAAGGCAAGCTAATGCTGTTTACCGTGTTTTGGTCAAACGTAACGAGTGAAATAGAATTTGCCTTTCTCATATTTAATTATCATGTAGTTTAATGTACCATATGTGAAACATTCTGGCCATAGCAGCAACTAAAAACTGCAAGCAACTTGGTAACAGAACTTTCTAAATAAACTTAACCTGTTCCAGAATGTCATGTATTTGACTTTTAAGCCCTATCTCAGTTGGTCAGTAAAGACCAATCCTTACTGTAGGAAATCATTGTTGTATCATCACAAACATCTATCTTTTGCTGTCCTGTCCAGTCCCATCAACTCCACACTGTGCCATTTGTGGCATCGTTTTGTTTATTTGGAGTTTGCTAAGGGCAGTATTTTTCTGTCAAGACTATTCAAGAAGGCATTATTTGAGATTCCTGTTCATTCTTGGTGTGTCTCTAACAGATACAGTATGTATACATTTGTATAATTGTTGTTGTTGAAAGTCCAGCTTTTTTGAGGTATATTTTAAATGTTTTAAGGATGCTTCTAAGGATCAGTAGTAATTTTTTTAGTTCGCACCTAAAGATGATTACATTGACCTCCCCCGACTGCTTACCAAATTAAAATGTGTCCACGAAGTAGCTTTGTGATCGCAGATACATTCATAGTGAACTCATCAGAATGGCTGGTTTGCAGTACTGAAATACTATCTTCTAGGCTGTATGTAGTGCTACAATTAGAGAAACAGAAGTCCAAGGCTGGCGACAGCTTGAAAAGTCTGACAGCTTTTCTACTTTTCCTGAAAATTTTAAGACTGTGATATCTGTCATTTTACTGTATAGCTGACTGTGTACTCAGGTATTTTATTGGTCCTTGAAAGATTGGTCGTTATGGATCACCCAGCCTTTCCAAGTCAGTGGCTGTTGTTCTGTCTTGCTGTCTGATACGAGAGTGGGGCTTTTCAGTGAACTAACCAGGGATTGTTCTTGACATACCTGACTTTTCTCACATTTGAACTTCCACTATCATTGTATCCATATAACTTCTAGCATTTTCATGCCATGGTAATCCATGAGCTACACATACGTAGCCCGGCACCGTGATGCAAGTTCATGGTATCGTGCATGTTCGTGGTATCATGGTATCATTCATGCGTGTTTGAATAGTTCTACATCTAGTGCTTCTTGCCAAAAAGAATACATTGTTTAAATTCACAAAATTAGCATAATTGCAGTGCTAATGAATATCGGAATATGTGCACAGTAACATTTGGACTATTCATTGGAGAGTTTACCCATACATTTAGCAAATTGAATGGCCAAAACATTTGACTCCAGTGAGGGCTCAAGTTAGATCCCTATAGAAAGAGGACACTTCATCTTACTTAAGTCATAGTTAAGATCTGTGATACGAACCATAGATATTGCCTGACAAAGCAGAAATCACCAAGTTTCCCCCTTTTGAATTACCACCAAGAAGTGTTGAAACACCAAATAGATATCATGTTATTTTGGGCATTTGCAGTTTTCTTCCCTGCTGCATGTAATGTCTCAGAATCAACATTCTTTTAAAATCTAGACTATATTTTGAGGCAATGAATTACTTATATTCAACTTAGGCTTGTTTTGACATTCAGTAGAACTTTAAGTTCAATCTAAAGGCTTCAGTCCACATTTTTTTATACGTTGTATTTTAAAAACGTTTGAAAGGAGTCTTACACCTGTATCATGAAAACTGAATCCTTTTGAAATACCACTATATGAAGAGAGAGATGAAATTTAGTGAACAGAATTGAAAAGGTGCTCATAATTTCACTATGCAAACTTACCCCAGTCTCTAAAAAAGTAATTTAGATTTAAAGTTCTTTGATGTATTTGATTTTCTAAATCTTTATGGTTATGATTTGGAATAAAATGTGCCTAATCCTGTGTTACATTCTGTTCTTAAATCTGAATGCCTTCTCATTTAATTCTGAGGAAATATCACACAAGTGTCTTCATTGACCTTGAAGAAATGTATATACAGTTGCCTTATAAAACAACATAAATTTAGACCATAACTTTTATAGAGAAAGGGTTTTGTCAAATGTTTTCTGAAAATCTGAGTAATTCAAAGCATGCCTCTGCCCCTTTAATATTTTTAATAACCTGCATTGTTGCTGTCTGCCAAATATTAAATTGAAATCTTCATTTCAATTTTATTATCTGGAAAGGGCACTGGATTGCTCTGCAACCAAAGAAAGCAATATGGAATGAAAAAACTCATTCACTTTTGTCTTATTTTCTTTTAAGGTGTATTGGCATGTAATTTGCATAGAGAAGGTCCTCTGGTTAGTCTCTCAAATTGAGGCTGTTTAGGGAAATCCTTATTCAGTTGGTGGCAGTGGTTGGTTTAAAGTAGAAGGAAATAAGATCGCCTTAATACCAGAAATGATTAGAAGTGCTGATTTAGATTCAACAAATACCATATGTCCTTATCATTTTTTGTAAGAAGAAATTGGTTAAGTCCTAACTTTCAATGTGTACCCAAATACTTGTATTTATGCTTTTGATAAAATGTATTTTCAGCATTAATACACATCCGATTATGCCTTATTTATATATGAAGAATAAAGTTACCATGTTACACTGTTATGTCCTAAAATTCAAATCACTATTTGAGAAACCCTCAAATTGGTGCTTTCATTATATAATGATACATTTAGACAAAACCCCAAACTAAGCCATTTGAAACAAGATTCTCTCCATTGCAGTTTGTAGCAATGTTATTTCTGTGTATGTCATGAGAAGGCTAAATATCAGTGTTAATTTCTTGTTTGAATCCGTGAAATCATGCCTGTAAAGCCCAAACATTTGTAACAAACTCCCTAATAAATTTAGAGAAAGTCACTC