Transcript asmbl_25455

Sequence
Transcript Sequence for observation asmbl_25455 of TGE0058952:
GGGGGCTGGGGGCTGCGCGGGGCGGGGCGGGCCCGGGCGCTCCGGGCCCCCTCCCCCGCCCCCCTGACGTCAGCCCCCGGCAGCCTCGAGCTGCTCACTTGGCTCTCGCCCTCCGGCCGGGAAGCATGGGGCTTCCCAGGCTGGTCTGCGCCTTCTTGCTCGCCGCCTGCTGCTGCTGTCCTCGCGTCGCGGGTGTGCCCGGAGAGGCTGAGCAGCCTGCGCCTGAGCTGGTGGAGGTGGAAGTGGGCAGCACAGCCCTTCTGAAGTGCGGCCTCTCCCAGTCCCAAGGCAACCTCAGCCATGTCGACTGGTTTTCTGTCCACAAGGAGAAGCGGACGCTCATCTTCCGTGTGCGCCAGGGCCAGGGCCAGAGCGAACCTGGGGAGTACGAGCAGCGGCTCAGCCTCCAGGACAGAGGGGCTACTCTGGCCCTGACTCAAGTCACCCCCCAAGACGAGCGCATCTTCTTGTGCCAGGGCAAGCGCCCTCGGTCCCAGGAGTACCGCATCCAGCTCCGCGTCTACAAAGCTCCGGAGGAGCCAAACATCCAGGTCAACCCCCTGGGCATCCCTGTGAACAGTAAGGAGCCTGAGGAGGTCGCTACCTGTGTAGGGAGGAACGGGTACCCCATTCCTCAAGTCATCTGGTACAAGAATGGCCGGCCTCTGAAGGAGGAGAAGAACCGGGTCCACATTCAGTCGTCCCAGACTGTGGAGTCGAGTGGTTTGTACACCTTGCAGAGTATTCTGAAGGCACAGCTGGTTAAAGAAGACAAAGATGCCCAGTTTTACTGTGAGCTCAACTACCGGCTGCCCAGTGGGAACCACATGAAGGAGTCCAGGGAAGTCACCGTCCCTGTTTTCTACCCGACAGAAAAAGTGTGGCTGGAAGTGGAGCCCGTGGGAATGCTGAAGGAAGGGGACCGCGTGGAAATCAGGTGTTTGGCTGATGGCAACCCTCCACCACACTTCAGCATCAGCAAGCAGGTGTGGGGGCTTTGTGCTGGGTGCAGGTGGGGATGCAAGCAGAGACCCAGGTGGAGTGGCGGGAGGTGCACTCTGC