Transcript asmbl_25885

Sequence
Transcript Sequence for observation asmbl_25885 of TGE0000912:
GCGGCCGGCACCTCATTCATTTCTACCGGTCTCTAGTAGTGCAGCTTCGGCTGGTGTCATCGGTGTCCTTCCTCCGCTGCCGCCCCCGCAAGGCTTCGCCGTCATCGAGGCCATTTCCAGCGACTTGTCGCACGCTTTTCTATATACTTCGTTCCCCGCCAACCGCAACCATTGACGCCATGTCGGGTTATTCGAGTGACCGAGACCGCGGCCGGGACCGAGGGTTTGGTGCACCTCGATTTGGAGGAAGTAGGGCAGGGCCCTTATCTGGAAAGAAGTTTGGAAACCCTGGGGAGAAATTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCTAAATTTGAGAAGAATTTTTATCAAGAGCACCCTGATTTGGCTAGGCGCACAGCACAAGAGGTGGAAACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGCCCGAAGCCAGTTCTAAATTTTTATGAAGCCAATTTCCCTGCAAATGTCATGGATGTTATTGCAAGACAGAATTTCACTGAACCCACTGCTATTCAAGCTCAGGGATGGCCAGTTGCTCTAAGTGGATTGGATATGGTTGGAGTGGCACAGACTGGATCTGGGAAAACATTGTCTTATTTGCTTCCTGCCATTGTCCACATCAATCATCAGCCATTCCTAGAGAGAGGCGATGGGCCTATTTGTTTGGTGCTGGCACCAACTCGGGAACTGGCCCAACAGGTGCAGCAAGTAGCTGCTGAATATTGTAGAGCATGTCGCTTGAAGTCTACTTGTATCTACGGTGGTGCTCCTAAGGGACCACAAATACGTGATTTGGAGAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGAAAAACCAATCTGAGAAGAACAACCTACCTTGTCCTTGATGAAGCAGATAGAATGCTTGATATGGGCTTTGAACCCCAAATAAGGAAGATTGTGGATCAAATAAGACCTGATAGGCAAACTCTAATGTGGAGTGCGACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGTGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGATGACCGTCGGGACAGATACTCTGCGGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAATTATGACAGAGGTTACTCTAGCCTGCTTAAAAGAGATTTTGGGGCAAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTGTCTGCTGGTATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAATGGTTATGATAGCACTCAGCAATACGGAAGTAATGTTCCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACTGCAGCTGCACCTATGATTGGTTATCCAATGCCAACAGGATATTCCCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCTGACAAGATAGTTATTTAAGAAACATGGGAATTGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAAATGTACAGTGATTTGAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAAATATTTGAAGACTGAATTAAGTGGAAATTGTACTTT