Transcript asmbl_134079

Sequence
Transcript Sequence for observation asmbl_134079 of TGE0056423:
TTCTCTAATGTGCTGCAGGTGTGGGATTAAGAAAAGCTATGCAATATCACTCTCTAGAAACTGCTGAGTCCCACCCCTGGACTTAACCCTTTCTGCACCTCAGCAAATGGAGCCTGCACCAAGTACTTGGTGGTCCACTTGATTCCCTAGGGCAAATGGGTGGTTTACATTTGCATAGCTCTATTTTATCCAGTCTTTACATTCAGAATCTTACCTAATGGCTAAAGGCAAAGTCAGAAACACAACTCCCAGTGACAGAGCTCTTTTCAGCTCCTTTTCCTATATCGTCTCTTCAGGTCCCTGAAAATACGACGTACAAACAATTTACAACACCTGGGGAAACTGAGATACCAAGAGATTTAAGTGGCTTCTCCCAAGTTACCTCAAATCTGAAGTGGGAGCAGAAGTAAATATTCAGGCTTTACAAAATGGAACTGCCTTTTATCTCTCCTGGTTTTCTCTGGCTCTCCTGTTAATTAAATCATGAGGAGTTACACTAGGAACAAAACTTTTGGTTTAAAAACTATTTTAATAGTAGGCATCCCCTCCCCCAAACAGATGTATCTTGGTCTCTCAGTCCCTCGGAGCAGACGAGATTAACCTTACCATTGGATTACATCTTAGAAGATGCCATAGGATGTGAGGCACAAGTAATGCCAAGTTTACACCCTGATTGAACAGGTGGCCCCTAGACAAGGCCAATTTAAGAACATCAAGATGCCTGCCTGGTCCTAAGCATCTCCCCCACCAAGCCTGAAGTACTGGCTGGGAATCATTCCCTTGAGAGAGCTTATAAGTAAAACCATGTTAAACTTCAAATAACAAATTAACATATTAACAACCATTAACACGCCAGTCTCCCTTTATCACGTCTCTAGAAGAGAGCACCATCTGAGGGAAAGAGATCGGGAACAGGCACGTTGCAAAAGGTGATCAAGGCAGTTCTGAAACACAGAGTGCCATCCTTGTGAGTGTGTCACAGGAGGGCCCTGGGTTCTGGAGGTGATGACAGTGGTCAGAGGAACTCAAATGTGAAAAGTGAGAAGTGATGAGGAACTGGGACCTGCCTCCCCATGTGCCCACGTTCAGCCTGAACTTTGGTACCCTCATCAGATGTCAGGAAGCGACTCTCGCAGCGATAACCTCAGACCTCCCGGTGCTGAAGTGTTCATCCTGCCAGGAAGTGGGGCTGTGAGGAGGAGCTGTGCCCTCCCTGGGGTGGGGAGAAGGCTGGTGCTAGCCCCTGAATACTGAGAAAAGCTAATAGGAGAGGAGGAGCGTCTAGCCAATAGCCATCTTCACTAGCTAATGCCAAGCAAGATACTAAAGCCTGACAAGAATAGAATTACAGCTCTTCATGAGACAAAAATAAAAATGGTATTAACCAAGGAAATAGAGATTTATGTTCTGCTAAAACGGCCTGCCTTTAGCATGCTTTTGACTTGTGATTCTGAAGAAATGTTTCACCTCCAGGCTGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGGAAAATCAAGCCTCCAGAAAAGGACAACTTGTTCAGAAGGAAAGCATGGACACCATTAACCACGCAAGTCAGCTGGTAGAGCAAGCCCATGATATGAGGGATAAAATCCAAGAGATCAACAACAAGATGCTCTATTATGGGGAAGAGCATGAACTTAGCCCCAAGGAAATCTCTGAGAAGCTGGTGTTGGCCCAGAAGATGCTTGAAGAGATTAGAAGCCGTCAACCATTTTTCACCCAACGGGAGCTCGTGGATGAGGAGGCAGATGAGGCTTACGAACTACTGAGCCAGGCTGAGAGCTGGCAGCGGCTGCACAATGAGACCCGCACTCTGTTTCCTGTCGTCCTGGAGCAGCTGGATGACTACAATGCTAAGTTGTCAGATCTCCAGGAAGCACTTGACCAGGCCCTTAACTATGTCAGGGATGCCGAAGACATGAACAGGGCCACAGCAGCCAGGCAGCGGGACCATGAGAAACAACAGGAAAGAGTGAGGGAACAAATGGAAGTGGTGAACATGTCTCTGAGCACATCTGCGGACTCTCTGACAACACCTCGTCTAACTCTTTCAGAACTTGATGATATAATAAAGAATGCGTCAGGGATTTATGCAGAAATAGATGGAGCCAAAAGTGAACTACAAGTAAAACTATCTAACCTAAGTAACCTCAGCCATGATTTAGTCCAAGAAGCTATTGACCATGCACAGGACCTTCAACAAGAAGCTAATGAATTGAGCAGGAAGTTGCACAGTTCAGATATGAACGGGCTGGTACAGAAGGCTTTGGATGCATCAAATGTCTATGAAAATATTGTTAATTATGTTAGTGAAGCCAATGAAACAGCAGAATTTGCTTTGAACACCACTGACCGAATTTATGATGCGGTGAGTGGGATTGATACTCAAATCATTTACCATAAAGATGAAAGTGAGAACCTCCTCAATCAAGCCAGAGAACTGCAAGCAAAGGCAGAGTCTAGCAGTGATGAAGCAGTGGCTGACACTAGCAGGCGTGTGGGTGGAGCCCTAGCAAGGAAAAGTGCCCTTAAAACCAGACTCAGTGATGCCGTTAAGCAACTACAAGCAGCAGAGAGAGGGGATGCCCAGCAGCGCCTGGGGCAGTCTAGACTGATCACCGAGGAAGCCAACAGGACGACGATGGAGGTGCAGCAGGCCACTGCCCCCATGGCCAACAATCTAACCAACTGGTCACAGAATCTTCAACATTTTGACTCTTCTGCTTACAACACTGCAGTGAACTCTGCTAGGGATGCAGTAAGAAATCTGACCGAGGTTGTCCCTCAGCTCCTGGATCAGCTTCGTACGGTTGAGCAGAAGCGACCTGCAAGCAACGTTTCTGCCAGCATCCAGAGGATCCGAGAGCTCATTGCTCAGACCAGAAGTGTTGCCAGCAAGATCCAAGTCTCCATGATGTTTGATGGCCAGTCAGCTGTGGAAGTGCACTCGAGAACCAGTATGGATGACTTAAAGGCCTTCACGTCTCTGAGCCTGTACATGAAACCCCCTGTGAAGCGGCCGGAACTGACCGAGACTGCAGATCAGTTTATCCTGTACCTCGGAAGCAAAAACGCCAAAAAAGAGTATATGGGTCTTGCAATCAAAAATGATAATCTGGTATACGTCTATAATTTGGGAACTAAAGATGTGGAGATTCCCCTGGACTCCAAGCCCGTCAGTTCCTGGCCTGCTTACTTCAGCATTGTCAAGATTGAAAGGGTGGGAAAACATGGAAAGGTGTTTTTAACAGTCCCGAGTCTAAGTAGCACAGCAGAGGAAAAGTTCATTAAAAAGGGGGAATTTTCGGGAGATGACTCTCTGCTGGACCTGGACCCTGAGGACACAGTGTTTTATGTTGGTGGAGTGCCTTCCAACTTCAAGCTCCCTACCAGCTTAAACCTGCCTGGCTTTGTTGGCTGCCTGGAACTGGCCACTTTGAATAATGATGTGATCAGCTTGTACAACTTTAAGCACATCTATAATATGGACCCCTCCACATCAGTGCCATGTGCCCGAGATAAGCTGGCCTTCACTCAGAGTCGGGCTGCCAGTTACTTCTTCGATGGCTCCGGTTATGCCGTGGTGAGAGACATCACAAGGAGAGGGAAATTTGGTCAGGTGACTCGCTTTGACATAGAAGTTCGAACACCAGCTGACAACGGCCTTATTCTCCTGATGGTCAATGGAAGTATGTTTTTCAGACTGGAAATGCGCAATGGTTACCTACATGTGTTCTATGATTTTGGATTCAGCGGTGGCCCTGTGCATCTTGAAGATACGTTAAAGAAAGCTCAAATTAATGATGCAAAATACCATGAGATCTCAATCATTTACCACAATGATAAGAAAATGATCTTGGTAGTTGACAGAAGGCATGTCAAGAGCATGGATAATGAAAAGATGAAAATACCTTTTACAGATATATACATTGGAGGAGCTCCTCCAGAAATCTTACAATCCAGGGCCCTCAGAGCACACCTTCCCCTAGATATCAACTTCAGAGGATGCATGAAGGGCTTCCAGTTCCAAAAGAAGGACTTCAATTTACTGGAGCAGACAGAAACCCTGGGAGTTGGTTATGGATGCCCAGAAGACTCACTTATATCTCGCAGAGCATATTTCAATGGACAGAGCTTCATTGCTTCAATTCAGAAAATATCTTTCTTTGATGGCTTTGAAGGAGGTTTTAATTTCCGAACATTACAACCAAATGGGTTACTATTCTATTATGCTTCAGGGTCAGACGTGTTCTCCATCTCACTGGATAATGGTACTGTCATCATGGATGTAAAGGGAATCAAAGTTCAGTCAGTAGATAAGCAGTACAATGATGGGCTGTCCCACTTCGTCATTAGCTCTGTCTCACCCACAAGATATGAACTGATAGTAGATAAAAGCAGAGTTGGGAGTAAGAATCCTACCAAAGGGAAAATAGAACAGACACAAGCAAGTGAAAAGAAGTTTTACTTCGGTGGCTCACCAATCAGTGCTCAGTATGCTAATTTCACTGGCTGCATAAGTAATGCCTACTTTACCAGGGTGGATAGAGATGTGGAGGTTGAAGATTTCCAACGGTATACTGAAAAGGTCCACACTTCTCTTTATGAGTGTCCCATTGAGTCTTCACCATTGTTTCTCCTCCATAAAAAAGGAAAAAATTTATCCAAGCCTAAAGCAAGTCAGAATAAAAAGGGAGGGAAAAGTAAAGATGCACCTTCATGGGATCCTGTTGCTCTGAAACTCCCAGAGCGGAATACTCCAAGAAACTCTCATTGCCACCTTTCCAACAGCCCTAGAGCAATAGAGCACGCCTATCAATATGGAGGAACAGCCAACAGCCGCCAAGAGTTTGAACACTTAAAAGGAGATTTTGGTGCCAAATCTCAGTTTTCCATTCGTCTGAGAACTCGTTCCTCCCATGGCATGATCTTCTATGTCTCAGATCAAGAAGAGAATGACTTCATGACTCTATTTTTGGCCCATGGCCGCTTGGTTTACATGTTTAATGTTGGTCACAAAAAACTGAAGATTAGAAGCCAGGAGAAATACAATGATGGCCTGTGGCATGATGTGATATTTATTCGAGAAAGGAGCAGTGGCCGACTGGTAATTGATGGTCTCCGAGTCCTAGAAGAAAGTCTTCCTCCTACTGAAGCTACCTGGAAAATCAAGGGTCCCATTTATTTGGGAGGTGTGGCTCCTGGAAAGGCTGTGAAAAATGTTCAGATTAACTCCATCTACAGTTTTAGTGGCTGTCTCAGCAATCTCCAGCTCAATGGGGCCTCCATCACCTCTGCTTCTCAGACATTCAGTGTGACCCCTTGCTTTGAAGGCCCCATGGAAACAGGAACTTACTTTTCAACAGAAGGAGGATACGTGGTTCTAGATGAATCTTTCAATATTGGATTGAAGTTTGAAATTGCATTTGAAGTCCGTCCCAGAAGCAGTTCCGGAACCCTGGTCCACGGCCACAGTGTCAATGGGGAGTACCTAAATGTTCACATGAAAAATGGACAGGTCATAGTGAAAGTCAATAATGGCATCAGAGATTTTTCCACCTCAGTTACACCCAAGCAGAGTCTCTGTGATGGCAGATGGCACAGAATTACAGTTATTAGAGATTCTAATGTGGTTCAGTTGGATGTGGACTCTGAAGTGAACCATGTGGTTGGACCCCTGAATCCAAAACCAATTGATCACAGGGAGCCTGTGTTTGTTGGAGGTGTTCCAGAATCTCTACTGACACCACGCTTGGCCCCCAGCAAACCCTTCACAGGCTGCATACGCCACTTTGTGATTGATGGACACCCAGTGAGCTTCAGTAAAGCAGCCCTGGTCAGCGGCGCCGTAAGCATCAACTCCTGTCCAGCAGCCTGACATGACAGAGCACAGCTGCCCAAATACAAAGTTCTTTAGAGCACTGAAAGAAACACAAAGCCAGCCAGGAGGAACAGTAACTCTTCCTTCGGGTGGAAGCTTTCATCGAGTTGAACAGGACTTAAACGAATCATCAGGGACCGGATATTTCTTATTTCTCATTTGGATTCTTAACCTTGAATCCAAAGTGTCTGCAATGGACAACAATTGAAGGAGTGGCAAACTTACTTGTATTGAGAGCACACGCAATTCCTACTGGTGAAATTACTGTTTCTGTTTCTAATAAAATAGAAGGGATTCCAAATAAACACTTGCACACATTTTTGAAGTGCGGCTAGATTCTCAGATTCACCTTTCTTCCAGGGAAGATAACTTTCAATCTATATAAAAATCTCTGTCCTAAAACTACCTTTCTTTATTTTGAAGAGACTTACTAACTTACATATAATCTAAATTAGATGATAGATTTGTTTTTAGCCCTTTTGTTTGGTCTATCAGTATAAGAAGAATATTTTAGGTTTATAGCTGAAGTTATCAAGGTTTAATAAAGTAAATTTCTAACAGAATACTAGAAAAATGCAGTATAATTTAATTTTTTCTAAATAAGAAACACAGGAAATCAACTACTTTTTCCCCTTCCTTATCTCCTTAAAAGAAAAATAAAATTGTACATGAGAGGAGGCTTCTGTAGGTTATTATTACCATTATTGTGTGTTCTATGGGAATCATTGAGGATATCACAGCAAAAACAGTAGGACAAAATCATAAAATTCAATTTAAGAGTACACAAGTCCTTTTATTAAAAGTTTGCTCCTAGCCTGGGCAACATAATGAGATCCCATCTCTGCAAAAAAATTTGTACATGGGCATACACCTGTAGTCCCAGCTACTTGGGAGGCTGAGACGGGAGGATCGCTTAAGCTCAGGAGTTCAAGGCTGCAGTGAGCTATGA