Transcript asmbl_133460

Sequence
Transcript Sequence for observation asmbl_133460 of TGE0056691:
TAGCCATGAAACCACAAACACTTTGCCTCCCCCTTCTGAGTCTTGGTGCCCTCATCCATAATACGGTTACAATATATACCTCACAGGCTTGTTGTTGTGAGGTTCAAACTAAATCCTTTATAAAATGTCCCTGAAACATTGTAGGTATGCAACAAATGTTGGCTATCTCCCCCTTAGTAGAAATCCGACTTCATGTGCACTCAGAACATTCTGTGAGAAAGTAAAATTGCTCTCTTTAACCTCAACTTTAAAACCTAGGGATATATCTTCAAGTTTCCCCATTACCTAATGATGACTATTATATTTTTACTCAATTTTGAAATTTACAAGTCATGTTCACATAGATCTTATCTCACTCTGGCCTAAAATGCTCCCATAAAATTGGCAGAACAAATTTAATCATTTTTATTTTATAGAATCAGGAACTGAAGTTCATAGAGATTAACATGCACTTTCTACAAGGACACACCCACTATCGGAACCCAGGTTTCTTGCAGCAAATCTAGTATTCCTCTCAAATGCCATCTAGGTTTCACCTTGGCTGTTACTTTCTAGCCAACCCTTGACTCCACTGCCCCATGTGCTCCCAAAGTATCTTGTACTTATTCTTTCATGGTACTTATCGCACTGTATTGCAGGGCTTCTCAAGCCTGACTATCTAACAGAATTATGTGAGACTTTTTGTAAAATATAATGGATTTAGGGCCTCACGTGATTTAGGTCCCACCTCCTTAATCAGGCGTCTATTTTTGTTTAAAGTTCTCCAGGTGACTCTGATGCACAGAATCATGCTTACTAAAGCATAAACTCTCTAATGGCAGCAACCAAATCTATTTTGTTCATCATTAGGATTCTGAATCCTTAAACAATATCTGGCAATACTATTCAATATTATTATCAATAACATTTACTGAGCATTTACTCTATGCCAGACACTATGATAAGTAATGTGTGTGCATTTGTTTCTGTTAATTCTGCCAATCGTCCTATGAAGAAGGAGTTATTATCACCCTATTTAAAGAGTGGGTAACTGAGGCTTGGAGAGGAGCTTGGGAAACATTTAGTAAATACATCAATGACTATTAGCAGTACAATTCATGCTTCCTACCTGCTTCCATGATAATAACTGGAACCTTCAAGAAAGTGATTATAAAATATGTAATAAAGGACTCTGGTACAGTCAGCTTTCAGGCACACATTAGTCATTGTCTCTAGAAAGTAGAATAGTAAAGCAGAGCCTTGGGAGAGCTTGGGGGCAGACAGCATGGCCCCAAGACACTATTTCTGAGTCCCACAAATAGCACATTTTAGTTGCTGAACCAATAGAAAATAGCCTGAATTCCTCCTAGATCATCTAATATTATTGTTCAATTTAAATACTTTTGGCTTCAAGTAGCAGAACTAATGTGGCTGAAACAGATGGGGACTGATTTTCTCATATAAGAAATCCTGAAATAGGTGGTCCTGATGCGGGCTTAGCCATTTAACAGCATCATTAAGGCCCCCAAATCCCCAAACGCCTCTCAGCTTTCTACTCTGCCACCTTCTCATTGTCAGCAGTGTTTCTGTTCACTGTCTCACGATGGCCACAGCAGCTTCAAGCATCCCTTCACCTGAAAACACCTGAAAACAGCTGAAAGCAGAAGGGGAAGGACAAACTCATCCATGTACCTCTCTCCTTTTTCAAAGGGGAAAAATGTTTCCCAGAAGCCACCTAGCAGACTTCCTCTTCCTCCTGGCAGTAGGTCACATAGCCACAGTTAGCCCAAAAGAAGTCCAGGGAAGCAAGCGATGGGCATGGTGGCATGGCATTGTCTTCTCTCCTGTGAGAGGTAGGACTTATCACAAGGACAGAGGAGGGAGAAAAATGGTTGCTTCTTAGACAGTTTATTATCTCAGCCTCAAATAATCTTTATTTAAAGTACTACTAAATCAACTAGATTCGCCTTTAGAATATTTTCAAAACCTGTTTGGCCCTATGATACGAATCCAATGTTGTTGAAGAAAGGGGCATGTCAGCTCCAGAGATCTCTAGACGACTGCTCTATGGACAGTTAAAGACTTTGGCAACAGCAGACATGTGATGATGGCTAATGCTCTCCTCTCCTGTTTCCAGGTCAACAGCGACCTCATTTACATTACAGCTAAGAAAGATGGCACTCATGTGGTGGAAAATGTGGATGCCACCCACATTGGGAAATTAATTGTGACCAAACAAATTGGAGGAGATGGCATGATGGATATTACTGATACTTACAAATTCCAAGAAGGTCAAGAAGAAGAGAGATTGGCCCTAGAAACTGCCCTGATGTACGGAGCTAAAAAGCCCCTCAACACAGAAGGTGTCATGAAATCAAGGTCCAACGTTGACATGGACTTTGAAGTGGAAAATGCTGTGCTGGGAAAAGACTTCAAGCTCTCCATCACCTTCCGGAACAACAGCCACAACCGTTACACCATCACAGCTTATCTCTCAGCCAACATCACCTTCTACACCGGGGTCCCGAAGGCAGAATTCAAGAAGGAGACGTTCGACGTGACGCTGGAGCCCTTGTCCTTCAAGAAAGAGGCGGTGCTGATCCAAGCCGGCGAGTACATGGGTCAGCTGCTGGAACAAGCGTCCCTGCACTTCTTTGTCACAGCTCGCATCAATGAGACCAGGGATGTTCTGGCCAAGCAAAAGTCCACCGTGCTAACCATCCCTGAGATCATCATCAAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTTTACCAATCCTTTAAAAGAAACCCTGCGAAATGTCTGGGTACACCTGGATGGTCCTGGAGTAACAAGACCAATGAAGAAGATGTTCCGTGAAATCCGGCCCAACTCCACCGTGCAGTGGGAAGAAGTGTGCCGGCCCTGGGTCTCTGGGCATCGGAAGCTGATAGCCAGCATGAGCAGTGACTCCCTGAGACATGTGTATGGCGAGCTGGACGTGCAGATTCAAAGACGACCTTCCATGTGAATGCACAGGAAGCTGAGATGAACCCTGGCATTTGGCCTCTTGTAGTCTTGGCTAAGGAAATTCTAACGCAAAAATAGCTCTTGCTTTGACTTAGGTGTGAAGACCCAGACAGGACTGCAGAGGGCTCCAGAGTGGAGATCCCACATATTTCAAAAACATGCTTTTCCAAACCCAGGCTATTCGGCAAGGAAGTTAGTTTTTAATCTCTCCACCTTCCAAAGAGTGCTAAGCATTAGCTTTAATTAAGCTCTCATAGCTCATAAGAGTAACAGTCATCATTTATCATCACAAATGGCTACATCTCCAAATATCAGTGGGCTCTCTTACCAGGGAGATTTGCTCAATACCTGGCCTCATTTAAAACAAGACTTCAGATTCCCCACTCAGCCTTTTGGGAATAATAGCACATGATTTGGGCTCTAGAATTCCAGTCCCCTTTCTCGGGGTCAGGTTCTACCCTCCATGTGAGAATATTTTTCCCAGGACTAGAGCACAACATAATTTTTATTTTTGGCAAAGCCAGAAAAAGATCTTTCATTTTGCACCTGCAGCCAAGCAAATGCCTGCCAAATTTTAGATTTACCTTGTTAGAAGAGGTGGCCCCATATTAACAAATTGCATTTGTGGGAAACTTAACCACCTACAAGGAGATAAGAAAGCAGGTGCAACACTCAAGTCTATTGAATAATGTAGTTTTGTGATGCATTTTATAGAATGTGTCACACTGTGGCCTGATCAGCAGGAGCCAATATCCCTTACTTTAACCCTTTCTGGGATGCAATACTAGGAAGTAAAGTGAAGAATTTATCTCTTTAGTTAGTGATTATATTTCACCCATCTCTCAGGAATCATCTCCTTTGCAGAATGATGCAGGTTCAGGTCCCCTTTCAGAGATATAATAAGCCCAACAAGTTGAAGAAGCTGGCGGATCTAGTGACCAGATATATAGAAGGACTGCAGCCACTGATTCTCTCTTGTCCTTCACATCACCCATGTTGAGACCTCAGCTTGGCACTCAGGTGCTGAAGGGTAATATGGACTCAGCCTTGCAAATAGCCAGTGCTAGTTCTGACCCAACCACAGAGGATGCTGACATCATTTGTATTATGTTCCAAGGCTACTACAGAGAAGGCTGCCTGCTATGTATTTGCAAGGCTGATTTATGGTCAGAATTTCCCTCTGATATGTCTAGGGTGTGATTTAGGTCAGTAGACTGTGATTCTTAGCAAAAAATGAACAGTGATAAGTATACTGGGGGCAAAATCAGAATGGAATGCTCTGGTCTATATAACCACATTTCTAAGCCTTTGAGACTGTTCCTGAGCCTTCAGCACTAACCTATGAGGGTGAGCTGGTCCCCTCTATATATACATCATACTTAACTTTACTAAGTAATCTCACAGCATTTGCCAAGTCTCCCAATATCCAATTTTAAAATGAAATGCATTTTGCTAGACAGTTAAACTGGCTTAACTTAGTATATTATTATTAATTACAATGTAATAGAAGCTTAAAATAAAGTTAAACTGATTAT