Transcript asmbl_101492

Sequence
Transcript Sequence for observation asmbl_101492 of TGE0056330:
CTCCCCTCCCCTCCCGCCCCTCTCGCCCCGCCCCTCCCCTCCTTGCCCTCCGCTCTCACTCTGGCTGGGAGCAGAAGGCAGCCTCGGTCTCTGGGCGGCGGCGGCGGCCCACTCTGCCCTGGCCGCGCTGTGTGGTGACCGCAGGCCCCAGACATGAGGGCGGCCCGTGCTCTGCTGCCCCTGCTGCTGCAGGCCTGCTGGACAGCCGCGCAGGATGAGCCGGAGACCCCGAGGGCCGTGGCCTTCCAGGACTGCCCCGTGGACCTGTTCTTTGTGCTGGACACCTCTGAGAGCGTGGCCCTGAGGCTGAAGCCCTACGGGGCCCTCGTGGACAAAGTCAAGTCCTTCACCAAGCGCTTCATCGACAACCTGAGGGACAGGTACTACCGCTGTGACCGAAACCTGGTGTGGAACGCAGGCGCGCTGCACTACAGTGACGAGGTGGAGATCATCCAAGGCCTCACGCGCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCGTGGACGCGGTCAAGTACTTTGGGAAGGGCACCTACACCGACTGCGCTATCAAGAAGGGGCTGGAGCAGCTCCTCGTGGGGGGCTCCCACCTGAAGGAGAATAAGTACCTGATTGTGGTGACCGACGGGCACCCCCTGGAGGGCTACAAGGAACCCTGTGGGGGGCTGGAGGATGCTGTGAACGAGGCCAAGCACCTGGGCGTCAAAGTCTTCTCGGTGGCCATCACACCCGACCACCTGGAGCCGCGTCTGAGCATCATCGCCACGGACCACACGTACCGGCGCAACTTCACGGCGGCTGACTGGGGCCAGAGCCGCGACGCAGAGGAGGCCATCAGCCAGACCATCGACACCATCGTGGACATGATCAAAAATAACGTGGAGCAAGTGTGCTGCTCCTTCGAATGCCAGCCTGCAAGAGGACCTCCGGGGCTCCGGGGCGACCCCGGCTTTGAGGGAGAACGAGGCAAGCCGGGGCTCCCAGGAGAGAAGGGAGAAGCCGGAGATCCTGGAAGACCCGGGGACCTCGGACCTGTTGGGTACCAGGGAATGAAGGGAGAAAAAGGGAGCCGTGGGGAGAAGGGCTCCAGGGGACCCAAGGGCTACAAGGGAGAGAAGGGCAAGCGTGGCATCGACGGGGTGGACGGCGTGAAGGGGGAGATGGGGTACCCAGGCCTGCCAGGCTGCAAGGGCTCGCCCGGGTTTGACGGCATTCAAGGACCCCCTGGCCCCAAGGGAGACCCCGGTGCCTTTGGACTGAAAGGAGAAAAGGGCGAGCCTGGAGCTGACGGGGAGGCGGGGAGACCAGGGAGCTCGGGACCATCTGGAGACGAGGGCCAGCCGGGAGAGCCTGGGCCCCCCGGAGAGAAAGGAGAGGCGGGCGACGAGGGGAACCCAGGACCTGACGGTGCCCCCGGGGAGCGGGGTGGCCCTGGAGAGAGAGGACCACGGGGGACCCCAGGCACGCGGGGACCAAGAGGAGACCCTGGTGAAGCTGGCCCGCAGGGTGATCAGGGAAGAGAAGGCCCCGTTGGTGTCCCTGGAGACCCGGGCGAGGCTGGCCCTATCGGACCTAAAGGCTACCGAGGCGATGAGGGTCCCCCAGGGTCCGAGGGTGCCAGAGGAGCCCCAGGACCTGCCGGACCCCCTGGAGACCCGGGGCTGATGGGTGAAAGGGGAGAAGACGGCCCCGCTGGAAATGGCACCGAGGGCTTCCCCGGCTTCCCCGGGTATCCGGGCAACAGGGGCGCTCCCGGGATAAACGGCACGAAGGGCTACCCCGGCCTCAAGGGGGACGAGGGAGAAGCCGGGGACCCCGGAGACGATAACAACGACATTGCACCCCGAGGAGTCAAAGGAGCAAAGGGGTACCGGGGTCCCGAGGGCCCCCAGGGACCCCCAGGACACCAAGGACCGCCTGGGCCGGACGAATGCGAGATTTTGGACATCATCATGAAAATGTGCTCTTGCTGTGGTGAGACCCAGGCTCTAGCTCCTGAGAGAATGGATCCCGGGGGTCGGGGAGCGAGGCCTGGGTCCCACACATGTCACAGGACAGCACATGGCACTCTGGTCCCCGCCCGCAGCTCCCTGCACCTGCCCGCCCCCTCTGGGGCCTGCTCCAAGCCAGCAGGGTTCCCGGGTGTTGGGCTGGGCCCCGCCCTCTTTCACCCATAACTGAAATAACCAGGAGCAGGCTTGGGGGGGTCCCTGCTCCATCATTCTGGCCCACAGGCCCCACCCTAGCCTGGCTGAGCAACGCCAGCCCTGACCAGCCGCCGGACAGAGCAGCCTTTACGGGGCCATGGGAGGGGGTGGGCTTTTCTGGGGCTGAGACGGGGGGACCCCAACGTGTCAGGTGAGG