Transcript asmbl_67380

Sequence
Transcript Sequence for observation asmbl_67380 of TGE0056073:
TGAGGCTCGGCCGACGCCCGTGCTCCTCCCGTCCTTTCCCCAGTCATTTTCTGCCCGGCTTGATTTCTGACATTTAAGTGTTTCTTTCGCTGTTCCAGGCTCTGTTCCTCTCCCGGCATTTCCTCCCTGAAGCCTCCAGGTTTCTCATTTGGTTTCTGCCTGCGTTCTTTTCTTTTCTCCACACATCACACTGGCATGCAGCATGTTGTGGCGTGTGAGCATGGGGTGGCCGTGGGTCTCTGTCCCTGACTAAGCCGCCCCTTGTCCCTTCTCAGATTATGTTTGAGACCTTCAACACCCCGGCCATGTACGTGGCCATCCAGGCCGTGCTGTCCCTCTACGCCTCTGGGCGCACCACTGGCATTGTCATGGACTCTGGAGACGGGGTCACCCACACGGTGCCCATCTACGAGGGCTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACCGACTACCTCATGAAGATCCTCACTGAGCGAGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGCGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGATGGCCACCGCCGCATCCTCCTCTTCTCTGGAGAAGAGCTACGAGCTGCCCGATGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGGTGTCCGGAGGCGCTGTTCCAGCCTTCCTTCCTGGGTATGGAATCTTGCGGCATCCACGAGACCACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACGGTGCTGTCGGGCGGCACCACCATGTACCCGGGCATTGCCGACAGGATGCAGAAGGAGATCACCGCCCTGGCGCCCAGCACCATGAAGATCAAGATCATCGCACCCCCAGAGCGCAAGTACTCGGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCGGGCCCCTCCATCGTCCACCGCAAATGCTTCTAAACGGACTCAGCAGATGCGTAGCATTTGCTGCATGGGTTAATTGAGAATAGAAATTTGCCCCTGGCAAATGCACACACCTCATGCTAGCCTCACGAAACTGGAATAAGCCTTCGAAAAGAAATTGTCCTTGAAGCTTGTATCTGATATCAGCACTGGATTGTAGAACTTGTTGCTGATTTTGACCTTGTATTGAAGTTAACTGTTCCCCTTGGTATTTGTTTAATACCCTGTACATATCTTTGAGTTCAACCTTTAGTACGTGTGGCTTGGTCACTTCGTGGCTAAGGTAAGAACGTGCTTGTGGAAGACAAGTCTGTGGCTTGGTGAGTCTGTGTGGCCAGCAGCCTCTGATCTGTGCAGGGTATTAACGTGTCAGGGCTGAGTGTTCTGGGATTTCTCTAGAGGCTGGCAAGAACCAGTTGTTTTGTCTTGCGGGTCTGTCAGGGTTGGAAAGTCCAAGCCGTAGGACCCAGTTTCCTTTCTTAGCTGATGTCTTTGGCCAGAACACCGTGGGCTGTTACTTGCTTTGAGTTGGAAGCGGTTTGCATTTACGCCTGTAAATGTATTCATTCTTAATTTATGTAAGGTTTTTTTTGTACGCAATTCTCGATTCTTTGAAGAGATGACAACAAATTTTGGTTTTCTACTGTTATGTGAGAACATTAGGCCCCAGCAACACGTCATTGTGTAAGGAAAAATAAAAGTGCTGCCGTAACC