Transcript asmbl_66948

Sequence
Transcript Sequence for observation asmbl_66948 of TGE0058788:
AGCAGTTCTGGCCGCTGTCCCGGTGCGCACGGACGTGGCTCGAGTTTCCTCTGCTCTCCGCTCTCGCCCGCTAGCTCTCCTCCCTTCCGCTCCTGCTTCTCTCCGGGTCTCCCGCTCCAGCTCCAGCCCCACCCGGCCGGTCCCGCACGGCTCCGGGTAGCCATGGAGGACCCCACGCTCTATATTGTCGAGCGGCCGCTTCCCGGGTACCCCGACGCCGAGGCCCCGGAGCCTTCCTCCGCTGGGGCTCAGGCAGCGGAGGAGCCGTCGGGGGCCGGCTCAGAAGAGCTGATCAAGTCGGACCAGGTGAACGGCGTGCTGGTGCTGAGCCTCCTGGACAAAATCATCGGGGCCGTAGACCAGATCCAGCTGACTCAAGCACAGCTGGAGGAGCGGCAGGCGGAGATGGAGGGCGCAGTGCAGAGCATCCAGGGCGAGCTGAGCAAGCTGGGCAAGGCGCACGCCACCACGAGCAATACGGTGAGCAAGCTGCTGGAGAAGGTGCGCAAGGTCAGCGTCAACGTGAAGACCGTGCGCGGCAGCCTGGAGCGCCAGGCGGGGCAGATCAAGAAGCTGGAGGTCAACGAGGCCGAGCTGCTGCGGCGCCGCAACTTTAAAGTCATGATCTACCAGCCCAAGAAGAAGCCGAATGCACCCTCTGACCTGGCCACACCCAAGATCGTGCCTTTTGACCTGCCTGAGACTGAGCCCTTTGACCTGAAGCCTGAGACAGTGCCTGAGCTCCCACCTTTTGACCAGACGCCTAGGGCACTGCCATATTACCCAGAGCCTGGGCCCCGGCCCACCCCAGAGGAGCTGACAGCCGGTGGGAGTGTTTAGGGTCTCCCGGATCCCGTTCTGTGGGCGTGGGGTATCTCTTCAGTCCACTGTCAGCCCACAGCCTAGTGGTGATCACTGCCAGGAGGGCCACCATCCCCAGTCACTGCCCACTGTGGACGGGTGCCGGGTACTGTGAGAACACTGGCGTTATGCAAAGTTCAGGAGAATGGGATGTATACAGTGGGGATGGGAGGGGAATGGAAGGGGCCTCCCCACTTCTTGGTTTCTGTTTTTAGTAGTAAATGCTCCCCCACACTTAAGCTGCACCCGAAGGCTGCCTAGCATGAAGGCGCATGGCTTCTGGTTCTGCCGTTCCCCCTGCTGCCTCCTCCTGAGGGACAACCCAGTTTGGCTCAAAGCCTCTTTGGAGAGGGCCATCATGAGGCTCAGGCCTGGGGTCTGTTCTGTGCCCTCTCCACCCACTCCCTGCAGCTGAGGAAAACATTTACACGTATTTTCTCCAGTTTCTTTTAGAAAATGCTTTGCAAAGAGATCGCTTATGTTTGCCAGATCCTGCCTTGGGTGGGGTGCCCAAAAGCTGCCAACTCACAGATGCCAGGAGGGGGACATTCTAGCTGGCTCTGGCTCAGGACCTCTGGCCTTCCTATAGCAGAGTGTTTCTCAACTTAAAAAAAATGTTAAAAAAATTTTTTTTAGAGATGGGGTTGGACTGTGTTGCCCAGGCTGGTTCTGAACTCCTGGGGCTCAAGTGATC