Transcript asmbl_25837

Sequence
Transcript Sequence for observation asmbl_25837 of TGE0000909:
GAGGTAGCTCACGCGATAGAAACGTGTTCGCTGCCCAGAAGAAGGGAAGGCGCGAGTGAGGAAAGGAGGTACTGTAGATGCCCTCCAAATCCTTGGTTATGGAATATTTGGCTCATCCCAGTACACTCGGCTTGGCTGTTGGAGTTGCTTGTGGCATGTGCCTGGGCTGGAGCCTTCGAGTATGCTTTGGGATGCTCCCCAAAAGCAAGACGAGCAAGACACACACAGATACTGAAAGTGAAGCAAGCATCTTGGGAGACAGCGGGGAGTACAAGATGATTCTTGTGGTTCGAAATGACTTAAAGATGGGAAAAGGGAAAGTGGCTGCCCAGTGCTCTCATGCTGCTGTTTCAGCCTACAAGCAGATTCAAAGAAGAAATCCTGAAATGCTCAAACAATGGGAATACTGTGGCCAGCCCAAGGTGGTGGTCAAAGCTCCTGATGAAGAAACCCTGATTGCATTATTGGCCCATGCAAAAATGCTGGGACTGACTGTAAGTTTAATTCAAGATGCTGGACGTACTCAGATTGCACCAGGCTCTCAAACTGTCCTAGGGATTGGGCCAGGACCAGCAGACCTAATTGACAAAGTCACTGGTCACCTAAAACTTTACTAGGTGGACTTTGATATGACAACAACCCCTCCATCACAAGTGTTTGAAGCCTGTCAGATTCTAACAACAAAAGCTGAATTTCTTCACCCAACTTAAATGTTCTTGAGATGAAAATAAAACCTATTCCCATGTTCTATGGTTGGCAGTTGTCATCTTGGGCTTAAAAACAGTACTGTTGGTTAAATGGTCTTGGTGGTTCAAGTGAGAGGCTGAAACAGATATTTAAGATGAGAGAAAC