Transcript asmbl_142949

Sequence
Transcript Sequence for observation asmbl_142949 of TGE0056079:
GAGAAAAAAATGCAGAGGCCGGTAATGAAGGAAATGATTGGATCTCATTCCCAATTGGTCATTCCTAAGATCACATGTTCTGAGCATCTTTAAAAGGAAGTTATCTGGACTCAAGAGGGTCACAGCACCCTCCTGAAAACTGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAAGCCAAGGGACGTTGACCTGGACTGAAGTTCGCATTGAACTCTACAACATTCTGTGGGATATATTGTTCAAAAAGATATTGTTGTTTTCCATGATTTAGCAAGCAACTAATTTTCTCCCAAGCTGATTTTATTCAATATGGTTACGTTGGTTAAATAAACTTTTTTTAGATTTAGAAGGTGATGTAATGATGTATTCATTGTGCTTATGATGTATTCTTAGTCATAACTGAGTGAAGGAAATGGGAAATTTGCATTATTTCTTTGTTCTGATATGAATAATAACATATTTCATAATAATTCAAGGTAAAAAGGGATATCTATGGATTTCCCTAGGTAGGAGATAACAAGTATGTACCATTACTGAATATTAAATCCTTCTTTACCATAGCTACAGTTAAGTAGGTGTATCTCAGAAACCTAAGGTAGTTTTAAATGTAGTGAAATTGTCCACAGCAAGCTGGCCCAAGTGCTCACATTTTATACCCGCTCTGTCTTAGTGCGTTGCAAGAGAGGAGTATATACAGTAGTTCCCCCTTATCCACAGGGGTACATTCTAAGACCCCCGGTGGGTGACTGAAACCACAGATAGTACCGAATCTTATACATACTATGTTTTTTTTCTAAACATAAATACCTACAATAAAGTTTAATTTTTAAATTAGGCACCATAATTAATAATAAAACAGAACAGTTATAACAATATACTATAATAAAATTATGTGTATGTGATCTCTCTTTCTCTCTCCCTCTCAAAATATTTTTAATATCTCTCCAGAATTCAGTGCAAATAATTCCATCATACTCACTTCAGAAAAGTGAAGATAGTCTTGTACATGAGTAGATTCAAATTTTATTGTCGTGGTTTCCAAAGTTTTATTTTTCTCACCAATGGAACTTTTGATTCAAATAAAATATCCAAGGGATTTCAGCTTATAAAACACACAAAATTGATAATGAGTTTTCCAAGGTACTGTGTGTGTGAATGTGTATGTCTGTGTATGTGTGTGTCGTCTGTATGTTTTTCCCACCTCTTGTAGAAGCTACGAAGCACCTTTCCATATTATTGAGGTTTCCTGTACGTAGACTGAAATTTACAAATCACATGCTTACATTTTATAGTAAGACAAAATCTGCCAAAGTGTATATTGCTGTTGATATAATTCTGTTTGTGATTCTCTCTTTAAAAATAAATCCAAAGGTTTTCATTTCCTGCATACTTATCCTATGCATAACACCATGATATGCAGAGGCCAGAAGAGATGGACTAGTTCACTGA