Transcript asmbl_25819

Sequence
Transcript Sequence for observation asmbl_25819 of TGE0000908:
CGTCGCGCGTGCGTGCGCGTGCGCTGAACGTAGCCCTCGCAGCACCCGTTGCGCTCCCGCGCGTGCGTGTTGGGATCGAATCGCTGTTTCCTTCCGCTTCTCTTCCTCTGTCTCCCCCCCATATCCGTGCGCCGAGCTGATAAAGGCGCCATTTTGGAGGGGCCGCGGGAGACGTGGTGCCGCTGCGGGCTCGCTCTGCCGTGCGCTAGGCTTGGTGGGAAGGCCTGTTCTCGAGTCCGCGCTTTTCGTCACCGCCATGTCGGGAGGTGGTGTGATTCGTGGCCCCGCAGGGAACAACGATTGCCGCATCTACGTGGGTAACTTACCTCCAGACATCCGAACCAAGGACATTGAGGACGTGTTCTACAAATACGGCGCTATCCGCGACATCGACCTCAAGAATCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGACGCGGTGTATGGTCGCGACGGCTATGATTACGATGGGTACCGTCTGCGGGTGGAGTTTCCTCGAAGCGGCCGTGGAACAGGCCGAGGCGGCGGCGGGGGTGGAGGTGGCGGAGCTCCCCGAGGTCGCTATGGCCCCCCATCCAGGCGGTCTGAAAACAGAGTGGTTGTCTCTGGACTGCCTCCAAGTGGAAGTTGGCAGGATTTAAAGGATCACATGCGTGAAGCAGGTGATGTATGTTATGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAGTTTGTACGGAAAGAAGATATGACCTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCATGAGGGAGAAACTGCCTACATCCGGGTTAAAGTTGATGGGCCCAGAAGTCCAAGTTATGGAAGATCTCGATCTCGAAGCCGTAGTCGTAGCAGAAGCCGTAGCAGAAGCAACAGCAGGAGTCGCAGTTACTCCCCAAGGAGAAGCAGAGGATCACCACGCTATTCTCCCCGTCATAGCAGATCTCGCTCTCGTACATAAGATGATTGGTGACACTTTTTGTAGAACCCATGTTGTATACAGTTTTCCTTTATTCAGTACAATCTTTTCATTTTTTAATTCAAACTGTTTTGTTCAGAATGGGCTAAAGTGTTGAATTGCATTCTTGTAATATCCCCTTGCTCCTAACATCTACATTCCCTTCGTGTCTTTGATAAATTGTATTTTAAGTGATGTCATAGACAGGATTGTTTAAATTTAGTTAACTCCATACTCTTCAGACTGTGATATTGTGTAAATGTCTATCTGCCCTGGTTTGTGTGAACTGGGATGTTGGGGGTGTTTGTGGTTATCTTACCTGGGGAAGTTCTTATGTTTATCTTGCTTTTCATGTGTCTTTCTGTAGACATATCTGAAGAGATGGATTAAGAATGCTTTGGATTAAGGATTGTGGAGCACATTTCAATCATTTTAGGATTGTCAAAAGGAGGATTGAGGAGGATCAGATCAATAATGGAGGCAATGGTATGACTCCAAGTGCTATTGTCACAGATGAAATTGGCAGTATTGACCTTATACTAAAAGGCAGGGGTTAAAAATGATTATATACATTTTCCTTAAAACACTTGCAAACATTTTATTCAGTTGTCTTTAGCTACAATTGCTTTGCTTTTTAAACCTTGGCAATTGTGGCAAAATTATATTGCCCATTTTGTAGCAACTTATTTTGCTCCCTTCCCCCCATTTTTGTTTTAATAGGGACTAATGTGGGAAGAACTGGCTAATTTGTCACAGTGCTTAGTTACAACTGTTAATGTGTGACCTGCTGTTGGTGTACATGTGGGTACAGGGTGTTTTTAAATCCAACAAGATAGAGTATAATATCAATACTGCTAAATCTGCATGTCCTCTGTGTGACTGATAGAGCGTTGCTATTTCATTTTTTTAAGACAAAATGAAAGCAAAATATAGAGTTCCAATGTATTGGTGTAGATAATCTAGTTGGGAATACTTTTAAGTCTCACCTTCCCCTTTAAACTAATATTCATAATTGGTTCATATGTTTAAAAGACTTTAATTTACAAATTAAATTGCAAATGGGAGCATTAGATTTAGTTTTAGACTTAGGTGGGTAGCAATGCCAGTAAACTTAAATTACGTAACTTCTTGCAACCACGAAACCTGTAATACGCTGTACAGTAACAAGTGTTGGCATTATCAGTTGAACTGTAAATACAAAATGCTTCTTCCAATTAGTCTCTATGATGATTAAGTTTCTAAAATTTATCTGAACACCATTCAGAAACTTGTTTTGGGGAATTTGATAGTTATTGATGTGCATCTGTTAAACTGATGACAGACATAACTCATCATTCCCCAGAAACCTTTTTTGATTACAGTATCTAACATTTTGCCTCCTCTTTTTTGGTTTTGCTGGTTATAAAGGTTTGGATTGGAGAGGGCTCACTGGATCCCAATCCTTGGAGCTGGATCATTGGATTCAAATCATAATGTGGATAGGATAGGGAGGATGAATTACCAGGATTCATGGAGCGGGATCAGATTACCAGGAACATAGGAGTGGATTCCTGCCCCAACCAAACCGCATTCGTGTGGATTTTTTTATTCAACTTAATTGGCTATTCCAAAGATTTTTTTTTTCCTATTTTTGACGATTGGAGCCCTTAAGATGCACGATGGAATTGTGTTTTGCGTTTTTTGGTAAAAGGAGCAAAGCGAGGACCTGGAGATAAACGCTGGAGCAATCTCCTTGGAAGGATTCAGCACGAGTAGATGGTAAACATTTAAAGGGGAAAGGGGGGGTTTGTTTAAAATAGTAAATCAGTAAGTCACTTCTAAATTTAAAGAAAACAAAATTGGAGTTGAAGAATAAGTAGGTTTCCAATTGGCTATTGCCGTTTTCTTTGAAAAAATAAACATTTTTTAAAAAACTATGCATGGTTGTCCTTTTTCCTCTTCATGTAAGATTCTAACTG