Transcript asmbl_132479

Sequence
Transcript Sequence for observation asmbl_132479 of TGE0058747:
CTGAGAAAGTAGGGTGGCCCTGAAAAGGGCCTTTTATTGATAGAAAGGGACGCTCAACCACCGAAACCGTAGAGGGTGCGGCCCTGGCGCTTGAGCGCGTAGACCACATCCATGGCGGTGACCGTCTTGCGCTTGGCGTGCTCTGTATAGGTCACGGCGTCCCGGATCACGTTCTCCAGGAACACCTTCAGCACCCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATGCGCTTCACGCCGCCGCGGCGAGCAAGGCGCCGGATGGCCGGCTTGGTGATGCCCTGGATATTGTCGCGCAGTACTTTACGGTGGCGCTTAGCGCCGCCTTTGCCAAGACCCTTCCCGCCTTTGCCGCGGCCAGACATGACGAGCAAGAGGAGTCTCAC