Transcript asmbl_91716

Sequence
Transcript Sequence for observation asmbl_91716 of TGE0058730:
GGCGATTACTGGGCAGGCTCAGTCTTTCGCCTCAGTCTCGAGCTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGGCCGCCATCGCCGTCGCTTGGCTTCTTCTGGACTCATCTGCGCCACTTGTCCGCTTCACACTCCGCCGCCATCATGGTGAAGCTCGCGAAGGCAGGTAAAAATCAAGGTGACCCCAAGAAAATGGCTCCTCCTCCAAAGGAGGTAGAAGAAGATAGTGAAGATGAGGAAATGTCAGAAGATGAAGAAGATGATAGCAGTGGAGAAGAGGTCGTCATACCTCAGAAGAAAGGCAAGAAGGCTGCTGCAACCTCAGCAAAGAAGGTGGTCGTTTCCCCAACAAAAAAGGTTGCAGTTGCCACACCAGCCAAGAAAGCAGCTGTCACTCCAGGCAAAAAGGCAGCAGCAACACCTGCCAAGAAGACAGTTACACCAGCCAAAGCAGTTACCACACCTGGCAAGAAGGGAGCCACACCAGGCAAAGCATTGGTAGCAACTCCTGGTAAGAAGGGTGCTGCCATCCCAGCCAAGGGGGCAAAGAATGGCAAGAATGCCAAGAAGGAAGACAGTGATGAAGAGGAGGATGATGACAGTGAGGAGGATGAGGAGGATGACGAGGACGAGGATGAGGATGAAGATGAAATTGAACCAGCAGCGATGAAAGCAGCAGCTGCTGCCCCTGCCTCAGAGGATGAGGACGATGAGGATGACGAAGATGATGAGGATGACGATGACGATGAGGAAGATGACTCTGAAGAAGAAGCTATGGAGACTACACCAGCCAAAGGAAAGAAAGCTGCAAAAGTTGTTCCTGTGAAAGCCAAGAACGTGGCTGAGGATGAAGATGAAGAAGAGGATGATGAGGACGAGGATGACGACGACGACGAAGATGATGAAGATGATGATGATGAAGATGATGAGGAGGAGGAAGAAGAGGAGGAGGAAGAGCCTGTCAAAGAAGCACCTGGAAAACGAAAGAAGGAAATGGCCAAACAGAAAGCAGCTCCTGAAGCCAAGAAACAGAAAGTGGAAGGCACAGAACCGACTACGGCTTTCAATCTCTTTGTTGGAAACCTAAACTTTAACAAATCTGCTCCTGAATTAAAAACTGGTATCAGCGATGTTTTTGCTAAAAATGATCTTGCTGTTGTGGATGTCAGAATTGGTATGACTAGGAAATTTGGTTATGTGGATTTTGAATCTGCTGAAGACCTGGAGAAAGCGTTGGAACTCACTGGTTTGAAAGTCTTTGGCAATGAAATTAAACTAGAGAAACCAAAAGGAAAAGACAGTAAGAAAGAGCGAGATGCGAGAACACTTTTGGCTAAAAATCTCCCTTACAAAGTCACTCAGGATGAATTGAAAGAAGTGTTTGAAGATGCTGCGGAGATCAGATTAGTCAGCAAGGATGGGAAAAGTAAAGGGATTGCTTATATTGAATTTAAGACAGAAGCTGATGCAGAGAAAACCTTTGAAGAAAAGCAGGGAACAGAGATCGATGGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTACTGACCGGGAAACTGGGTCCTCCAAAGGGTTTGGTTTTGTAGACTTCAACAGTGAGGAGGATGCCAAAGCTGCCAAGGAGGCCATGGAAGACGGTGAAATTGATGGAAATAAAGTTACCTTGGACTGGGCCAAACCTAAGGGTGAAGGTGGCTTCGGGGGTCGTGGTGGAGGCAGAGGCGGCTTTGGAGGACGAGGTGGTGGTAGAGGAGGCCGAGGAGGATTTGGTGGCAGAGGCCGGGGAGGCTTTGGAGGGCGAGGAGGCTTCCGAGGAGGCAGAGGAGGAGGAGGTGACCACAAGCCACAAGGAAAGAAGACGAAGTTTGAATAGCTTCTGTCCCTCTGCTTTCCCTTTTCCATTTGAAAGAAAGGACTCTGGGGTTTTTACTGTTACCTGATCAATGACAGAGCCTTCTGAGGACATTCCAAGACAGTATACAGTCCTGTGGTCTCCTTGGAAATCCGTCTAGTTAACATTTCAAGGGCAATACCGTGTTGGTTTTGACTGGATATTCATATAAACTTTTTAAAGAGTTGAGTGATAGAGCTAACCCTTATCTGTAAGTTTTGAATTTATATTGTTTCATCCCATGTACAAAACCATTTTTTCCTACAAATAGTTTGGGTTTTGTTGTTGTTTCTTTTTTTTGTTTTGTTTTTGTTTTT