Transcript asmbl_91715

Sequence
Transcript Sequence for observation asmbl_91715 of TGE0058729:
GGCGATTACTGGGCAGGCTCAGTCTTTCGCCTCAGTCTCGAGCTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGGCCGCCATCGCCGTCGCTTGGCTTCTTCTGGACTCATCTGCGCCACTTGTCCGCTTCACACTCCGCCGCCATCATGGTGAAGCTCGCGAAGGCAGGTAAAAATCAAGGTGACCCCAAGAAAATGGCTCCTCCTCCAAAGGAGGTAGAAGAAGATAGTGAAGATGAGGAAATGTCAGAAGATGAAGAAGATGATAGCAGTGGAGAAGAGGTCGTCATACCTCAGAAGAAAGGCAAGAAGGCTGCTGCAACCTCAGCAAAGAAGGTGGTCGTTTCCCCAACAAAAAAGGTTGCAGTTGCCACACCAGCCAAGAAAGCAGCTGTCACTCCAGGCAAAAAGGCAGCAGCAACACCTGCCAAGAAGACAGTTACACCAGCCAAAGCAGTTACCACACCTGGCAAGAAGGGAGCCACACCAGGCAAAGCATTGGTAGCAACTCCTGGTAAGAAGGGTGCTGCCATCCCAGCCAAGGGGGCAAAGAATGGCAAGAATGCCAAGAAGGAAGACAGTGATGAAGAGGAGGATGATGACAGTGAGGAGGATGAGGAGGATGACGAGGACGAGGATGAGGATGAAGATGAAATTGAACCAGCAGCGATGAAAGCAGCAGCTGCTGCCCCTGCCTCAGAGGATGAGGACGATGAGGATGACGAAGATGATGAGGATGACGATGACGATGAGGAAGATGACTCTGAAGAAGAAGCTATGGAGACTACACCAGCCAAAGGAAAGAAAGCTGCAAAAGTTGTTCCTGTGAAAGCCAAGAACGTGGCTGAGGATGAAGATGAAGAAGAGGATGATGAGGACGAGGATGACGACGACGACGAAGATGATGAAGATGATGATGATGAAGATGATGAGGAGGAGGAAGAAGAGGAGGAGGAAGAGCCTGTCAAAGAAGCACCTGGAAAACGAAAGAAGGAAATGGCCAAACAGAAAGCAGCTCCTGAAGCCAAGAAACAGAAAGTGGAAGGCACAGAACCGACTACGGCTTTCAATCTCTTTGTTGGAAACCTAAACTTTAACAAATCTGCTCCTGAATTAAAAACTGGTATCAGCGATGTTTTTGCTAAAAATGATCTTGCTGTTGTGGATGTCAGAATTGGTATGACTAGGAAATTTGGTTATGTGGATTTTGAATCTGCTGAAGACCTGGAGAAAGCGTTGGAACTCACTGGTTTGAAAGTCTTTGGCAATGAAATTAAACTAGAGAAACCAAAAGGAAAAGACAGTAAGAAAGAGCGAGATGCGAGAACACTTTTGGCTAAAAATCTCCCTTACAAAGTCACTCAGGATGAATTGAAAGAAGTGTTTGAAGATGCTGCGGAGATCAGATTAGTCAGCAAGGATGGGAAAAGTAAAGGGATTGCTTATATTGAATTTAAGACAGAAGCTGATGCAGAGAAAACCTTTGAAGAAAAGCAGGGAACAGAGATCGATGGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTACTGACCGGGAAACTGGGTCCTCCAAAGGGTTTGGTTTTGTAGACTTCAACAGTGAGGAGGATGCCAAAGCTGCCAAGGAGGCCATGGAAGACGGTGAAATTGATGGAAATAAAGTTACCTTGGACTGGGCCAAACCTAAGGGTGAAGGTGGCTTCGGGGGTCGTGGTGGAGGCAGAGGCGGCTTTGGAGGACGAGGTGGTGGTAGAGGAGGCCGAGGAGGATTTGGTGGCAGAGGCCGGGGAGGCTTTGGAGGTAAGGCACGCAGAGATAATGACACCACATAGCATGTGCTCTTCAGACCCTGTGCCCTGTCACGGTTCCTAATCACTGGGGAGGAGGAGCTTTGTACCCATTCTTTTAACAGTGTCTTGCCTTCCTCCTGTAGGGCGAGGAGGCTTCCGAGGAGGCAGAGGAGGAGGAGGTGACCACAAGCCACAAGGAAAGAAGACGAAGTTTGAATAGCTTCTGTCCCTCTGCTTTCCCTTTTCCATTTGAAAGAAAGGACTCTGGGGTTTTTACTGTTACCTGATCAATGACAGAGCCTTCTGAGGACATTCCAAGACAGTATACAGTCCTGTGGTCTCCTTGGAAATCCGTCTAGTTAACATTTCAAGGGCAATACCGTGTTGGTTTTGACTGGATATTCATATAAACTTTTTAAAGAGTTGAGTGATAGAGCTAACCCTTATCTGTAAGTTTTGAATTTATATTGTTTCATCCCATGTACAAAACCATTTTTTCCTACAAATAGTTTGGGTTTTGTTGTTGTTTCTTTTTTTTGTTTTGTTTTTGTTTTT