Transcript asmbl_91597

Sequence
Transcript Sequence for observation asmbl_91597 of TGE0058727:
GGGTCGTTGCTGCTCGCCTGCCAATGTCGCAGGCGCTCTGGGCTGAGCTGTCGCAAGGGCTGGGGGCGGGCCGGCTTCTGGGGCTCCCGCGTCTCCGCCCCTGCCCGCCGGGGCGCCAGGCCGGATGGGCTGCACTGTGAGCCTGGTGTGCTGCGAAGAGCTGCGGCCCGGACCACTCTGCGGTCCCCAGCCCCCGGGGAGTCCCTGGGTCTCGGCGCGGGCTGAGTGCTGGGAGTCCGGGGGTTTGGCCTGTGCAGAGAGAAGGCAGCTACCGCTTCAGCCAGAGGATCTGGAGGCCCCCAAGACACACCGCTTCAAGGTGAAGACCTTCAAGAAGGTGAAGCCCTGTGGGATCTGCCGCCAGGTCATCACCCAGGAAGGCTGCACCTGCAAAGTCTGCAGCTTCTCCTGTCATCGGAAATGCCAGGCCAAGCCATCCACCCACCCACCGCCAGCGTGCTCTTCCTCTGTGACCGATGTCTCCCGTGTAGCCATGAACCTGCATGCTCAGGATGCAGACGACGGTTTGGGAAGAGGGTGCGTGACTGCCGTGTGGGACTGCATGTCAGCTTCCCATGAAGGGGCACCTTGGGTGGCTGCCCCCTGCGTTCCTCCATCCAACCATGAGCTGGTGCCCATCACCACTGAGAATGCACCAAAGAATGTAGTGGACAAGGGAGAAGGAGCCTCCCGGGGTGGAAACACACGGAAAAGCCTCGAGGACAACGGCTCCACCAGGGTCACCCCGAGTGTCCAGCCCCACCTCCAGCCCATCAGAAACATGAGTGTGAGCCGGACCATGGAGGACAGCTGTGAGCTGGACCTGGTGTACGTCACAGAGAGGATCATCGCTGTCTCCTTCCCCAGCACAGCCAATGAGGAGAACTTCCGGAGCAACCTCCGTGAGGTGGCGCAGATGCTCAAGTCCAAACATGGAGGCAACTACCTGCTGTTCAACCTCTCTGAGCGGAGACCTGACATCACGAAGCTCCATGCCAAGGTACTGGAATTTGGCTGGCCCGACCTCCACACCCCAGCCCTGGAGAAGATCTGCAGCATCTGTAAGGCCATGGACACATGGCTCAATGCAGACCCTCACAATGTCGTTGTTCTACACAACAAGGGAAACCGAGGCAGGATAGGAGTTGTCATCGCGGCTTACATGCACTACAGCAACATTTCTGCCAGTGCGGACCAGGCTCTGGACCGGTTTGCAATGAAGCGGTTCTATGAGGATAAGATTGTGCCCATTGGCCAGCCATCCCAAAGAAGGTACGTGCATTACTTCAGTGGCCTGCTCTCCGGCTCCATCAAAATGAACAACAAGCCCTTGTTTCTGCACCACGTGATCATGCACGGCATCCCCAACTTTGAGTCTAAAGGAGGATGTCGGCCATTTCTCCGCATCTACCAGGCCATGCAACCTGTGTACACATCTGGCATCTACAACATCCCAGGAGACAGCCAGACTAGCGTCTGCATCACCATCGAGCCAGGACTGCTCTTGAAGGGAGACATCTTGCTGAAGTGCTACCACAAGAAGTTCCGAAGCCCAGCCCGAGACGTCATCTTCCGTGTGCAGTTCCACACCTGTGCCATCCATGACCTGGGGGTTGTCTTTGGGAAGGAGGACCTTGATGATGCTTTCAAAGATGATCGATTTCCAGAGTATGGCAAAGTGGAGTTTGTATTTTCTTATGGGCCAGAGAAAATTCAAGGCATGGAGCACCTGGAGAACGGGCCGAGCGTGTCTGTGGACTATAACACCTCCGACCCCCTCATCCGCTGGGACTCCTACGACAACTTCAGTGGGCATCGAGATGACGGCATGGAGGAGGTGGTGGGACACACGCAGGGGCCACTAGATGGGAGCCTGTATGCTAAGGTGAAGAAGAAAGACTCCCTGCACGGCAGCACCGGGGCTGTTAATGCCACACGTCCTACACTGTCGGCCACCCCCAACCACGTGGAACACACGCTTTCTGTGAGCAGCGACTCGGGCAACTCCACAGCCTCCACCAAGACCGACAAGACCGACGAGCCTGTCCCCGGGGCCTCCAGTGCCACTGCTGCCTTGAGTCCCCAGGAGAAGCGGGAGCTGGACCGCCTGCTGAGTGGCTTTGGCTTAGAGCGAGAGAAGCAAGGCGCCATGTACCACACCCAGCACCTCAGGTCCCGCCCAGCAGGGGGCTCGGCTGTGCCCTCCTCTGGACGCCACGTTGTCCCAGCCCAGGTTCATGTCAATGGTGGGGCGTTAGCATCTGAGCGGGAGACAGACATCCTGGACGATGAATTGCCAAACCAGGATGGTCACAGTGCGGGCAGCATGGGCACACTCTCTTCTCTGGACGGGGTCACCAACACCAGTGAGGGGGGCTACCCAGAGGCCCTGTCCCCACTGACCAACGGTCTGGACAAGTCCTACCCCATGGAGCCTATGGTCAATGGAGGAGGCTACCCCTACGAGTCTGCCAGCCGGGCGGGGCCTGCCCATGCTGGCCACACGGCCCCCATGCGGCCCTCCTACTCTGCACAGGAGGGTTTAGCTGGCTACCAGAGGGAGGGGCCCCACCCAGCCTGGCCACAGCCAGTGACCACCTCCCACTATGCCCATGACCCCAGCGGTATGTTCCGCTCTCAATCCTTTTCGGAAGCTGAACCCCAGCTGCCCCCAGCTCCGGTCCGAGGGGGAAGCAGCCGGGAGGCTGTGCAAAGGGGACTGAATTCGTGGCAGCAGCAGCAGCAGCAGCAGC