Transcript asmbl_91596

Sequence
Transcript Sequence for observation asmbl_91596 of TGE0058726:
AGGATAGCTTCCCCCACGCAGGCTGCTGCTCACCTCCTCCGCGCTGCGTGCAGCCATCTGGCAATCATGAACTGAGCTGTCCTCTGGGTCAGATGCTGTGCCAGGTCCTGGTGCTGAGAGCCAGCCCCTTACCTGGGAAGACAGACACAGTCAGACAATCATGGAGCACGGTACCAAAGCTGACACAGTCTGCAGCTTCTCCTGTCATCGGAAATGCCAGGCCAAGGTGGCTGCCCCCTGCGTTCCTCCATCCAACCATGAGCTGGTGCCCATCACCACTGAGAATGCACCAAAGAATGTAGTGGACAAGGGAGAAGGAGCCTCCCGGGGTGGAAACACACGGAAAAGCCTCGAGGACAACGGCTCCACCAGGGTCACCCCGAGTGTCCAGCCCCACCTCCAGCCCATCAGAAACATGAGTGTGAGCCGGACCATGGAGGACAGCTGTGAGCTGGACCTGGTGTACGTCACAGAGAGGATCATCGCTGTCTCCTTCCCCAGCACAGCCAATGAGGAGAACTTCCGGAGCAACCTCCGTGAGGTGGCGCAGATGCTCAAGTCCAAACATGGAGGCAACTACCTGCTGTTCAACCTCTCTGAGCGGAGACCTGACATCACGAAGCTCCATGCCAAGGTACTGGAATTTGGCTGGCCCGACCTCCACACCCCAGCCCTGGAGAAGATCTGCAGCATCTGTAAGGCCATGGACACATGGCTCAATGCAGACCCTCACAATGTCGTTGTTCTACACAACAAGGGAAACCGAGGCAGGATAGGAGTTGTCATCGCGGCTTACATGCACTACAGCAACATTTCTGCCAGTGCGGACCAGGCTCTGGACCGGTTTGCAATGAAGCGGTTCTATGAGGATAAGATTGTGCCCATTGGCCAGCCATCCCAAAGAAGGTACGTGCATTACTTCAGTGGCCTGCTCTCCGGCTCCATCAAAATGAACAACAAGCCCTTGTTTCTGCACCACGTGATCATGCACGGCATCCCCAACTTTGAGTCTAAAGGAGGATGTCGGCCATTTCTCCGCATCTACCAGGCCATGCAACCTGTGTACACATCTGGCATCTACAACATCCCAGGAGACAGCCAGACTAGCGTCTGCATCACCATCGAGCCAGGACTGCTCTTGAAGGGAGACATCTTGCTGAAGTGCTACCACAAGAAGTTCCGAAGCCCAGCCCGAGACGTCATCTTCCGTGTGCAGTTCCACACCTGTGCCATCCATGACCTGGGGGTTGTCTTTGGGAAGGAGGACCTTGATGATGCTTTCAAAGATGATCGATTTCCAGAGTATGGCAAAGTGGAGTTTGTATTTTCTTATGGGCCAGAGAAAATTCAAGGCATGGAGCACCTGGAGAACGGGCCGAGCGTGTCTGTGGACTATAACACCTCCGACCCCCTCATCCGCTGGGACTCCTACGACAACTTCAGTGGGCATCGAGATGACGGCATGGAGGAGGTGGTGGGACACACGCAGGGGCCACTAGATGGGAGCCTGTATGCTAAGGTGAAGAAGAAAGACTCCCTGCACGGCAGCACCGGGGCTGTTAATGCCACACGTCCTACACTGTCGGCCACCCCCAACCACGTGGAACACACGCTTTCTGTGAGCAGCGACTCGGGCAACTCCACAGCCTCCACCAAGACCGACAAGACCGACGAGCCTGTCCCCGGGGCCTCCAGTGCCACTGCTGCCTTGAGTCCCCAGGAGAAGCGGGAGCTGGACCGCCTGCTGAGTGGCTTTGGCTTAGAGCGAGAGAAGCAAGGCGCCATGTACCACACCCAGCACCTCAGGTCCCGCCCAGCAGGGGGCTCGGCTGTGCCCTCCTCTGGACGCCACGTTGTCCCAGCCCAGGTTCATGTCAATGGTGGGGCGTTAGCATCTGAGCGGGAGACAGACATCCTGGACGATGAATTGCCAAACCAGGATGGTCACAGTGCGGGCAGCATGGGCACACTCTCTTCTCTGGACGGGGTCACCAACACCAGTGAGGGGGGCTACCCAGAGGCCCTGTCCCCACTGACCAACGGTCTGGACAAGTCCTACCCCATGGAGCCTATGGTCAATGGAGGAGGCTACCCCTACGAGTCTGCCAGCCGGGCGGGGCCTGCCCATGCTGGCCACACGGCCCCCATGCGGCCCTCCTACTCTGCACAGGAGGGTTTAGCTGGCTACCAGAGGGAGGGGCCCCACCCAGCCTGGCCACAGCCAGTGACCACCTCCCACTATGCCCATGACCCCAGCGGTATGTTCCGCTCTCAATCCTTTTCGGAAGCTGAACCCCAGCTGCCCCCAGCTCCGGTCCGAGGGGGAAGCAGCCGGGAGGCTGTGCAAAGGGGACTGAATTCGTGGCAGCAGCAGCAGCAGCAGCAGC