Transcript asmbl_91594

Sequence
Transcript Sequence for observation asmbl_91594 of TGE0058725:
GCTGGAGGCAGCAGGGCGAGAGGCCCAGCAGATGCTGGCGGAGCCGGAGCAGCCGCGGACTCAGAGAGCCCTTCTGCCAGCGCCGCGGGGACTCTAGCTTCAGGGGCTCTTCACAGGCCCTGGGCGTGCCTCAGTGACGGGACCCAGCAAAGATGACGTGGATCTGTCTGTCCTGCATGCTCTGGCCAGAGGATCTGGAGGCCCCCAAGACACACCGCTTCAAGGTGAAGACCTTCAAGAAGGTGAAGCCCTGTGGGATCTGCCGCCAGGTCATCACCCAGGAAGGCTGCACCTGCAAAGTCTGCAGCTTCTCCTGTCATCGGAAATGCCAGGCCAAGGTGGCTGCCCCCTGCGTTCCTCCATCCAACCATGAGCTGGTGCCCATCACCACTGAGAATGCACCAAAGAATGTAGTGGACAAGGGAGAAGGAGCCTCCCGGGGTGGAAACACACGGAAAAGCCTCGAGGACAACGGCTCCACCAGGGTCACCCCGAGTGTCCAGCCCCACCTCCAGCCCATCAGAAACATGAGTGTGAGCCGGACCATGGAGGACAGCTGTGAGCTGGACCTGGTGTACGTCACAGAGAGGATCATCGCTGTCTCCTTCCCCAGCACAGCCAATGAGGAGAACTTCCGGAGCAACCTCCGTGAGGTGGCGCAGATGCTCAAGTCCAAACATGGAGGCAACTACCTGCTGTTCAACCTCTCTGAGCGGAGACCTGACATCACGAAGCTCCATGCCAAGGTACTGGAATTTGGCTGGCCCGACCTCCACACCCCAGCCCTGGAGAAGATCTGCAGCATCTGTAAGGCCATGGACACATGGCTCAATGCAGACCCTCACAATGTCGTTGTTCTACACAACAAGGGAAACCGAGGCAGGATAGGAGTTGTCATCGCGGCTTACATGCACTACAGCAACATTTCTGCCAGTGCGGACCAGGCTCTGGACCGGTTTGCAATGAAGCGGTTCTATGAGGATAAGATTGTGCCCATTGGCCAGCCATCCCAAAGAAGGTACGTGCATTACTTCAGTGGCCTGCTCTCCGGCTCCATCAAAATGAACAACAAGCCCTTGTTTCTGCACCACGTGATCATGCACGGCATCCCCAACTTTGAGTCTAAAGGAGGATGTCGGCCATTTCTCCGCATCTACCAGGCCATGCAACCTGTGTACACATCTGGCATCTACAACATCCCAGGAGACAGCCAGACTAGCGTCTGCATCACCATCGAGCCAGGACTGCTCTTGAAGGGAGACATCTTGCTGAAGTGCTACCACAAGAAGTTCCGAAGCCCAGCCCGAGACGTCATCTTCCGTGTGCAGTTCCACACCTGTGCCATCCATGACCTGGGGGTTGTCTTTGGGAAGGAGGACCTTGATGATGCTTTCAAAGATGATCGATTTCCAGAGTATGGCAAAGTGGAGTTTGTATTTTCTTATGGGCCAGAGAAAATTCAAGGCATGGAGCACCTGGAGAACGGGCCGAGCGTGTCTGTGGACTATAACACCTCCGACCCCCTCATCCGCTGGGACTCCTACGACAACTTCAGTGGGCATCGAGATGACGGCATGGAGGAGGTGGTGGGACACACGCAGGGGCCACTAGATGGGAGCCTGTATGCTAAGGTGAAGAAGAAAGACTCCCTGCACGGCAGCACCGGGGCTGTTAATGCCACACGTCCTACACTGTCGGCCACCCCCAACCACGTGGAACACACGCTTTCTGTGAGCAGCGACTCGGGCAACTCCACAGCCTCCACCAAGACCGACAAGACCGACGAGCCTGTCCCCGGGGCCTCCAGTGCCACTGCTGCCTTGAGTCCCCAGGAGAAGCGGGAGCTGGACCGCCTGCTGAGTGGCTTTGGCTTAGAGCGAGAGAAGCAAGGCGCCATGTACCACACCCAGCACCTCAGGTCCCGCCCAGCAGGGGGCTCGGCTGTGCCCTCCTCTGGACGCCACGTTGTCCCAGCCCAGGTTCATGTCAATGGTGGGGCGTTAGCATCTGAGCGGGAGACAGACATCCTGGACGATGAATTGCCAAACCAGGATGGTCACAGTGCGGGCAGCATGGGCACACTCTCTTCTCTGGACGGGGTCACCAACACCAGTGAGGGGGGCTACCCAGAGGCCCTGTCCCCACTGACCAACGGTCTGGACAAGTCCTACCCCATGGAGCCTATGGTCAATGGAGGAGGCTACCCCTACGAGTCTGCCAGCCGGGCGGGGCCTGCCCATGCTGGCCACACGGCCCCCATGCGGCCCTCCTACTCTGCACAGGAGGGTTTAGCTGGCTACCAGAGGGAGGGGCCCCACCCAGCCTGGCCACAGCCAGTGACCACCTCCCACTATGCCCATGACCCCAGCGGTATGTTCCGCTCTCAATCCTTTTCGGAAGCTGAACCCCAGCTGCCCCCAGCTCCGGTCCGAGGGGGAAGCAGCCGGGAGGCTGTGCAAAGGGGACTGAATTCGTGGCAGCAGCAGCAGCAGCAGCAGC